Incidental Mutation 'R6020:Adamts15'
ID 478870
Institutional Source Beutler Lab
Gene Symbol Adamts15
Ensembl Gene ENSMUSG00000033453
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 15
Synonyms
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6020 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 30810451-30833748 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 30813358 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 936 (R936S)
Ref Sequence ENSEMBL: ENSMUSP00000067022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065112]
AlphaFold P59384
Predicted Effect probably benign
Transcript: ENSMUST00000065112
AA Change: R936S

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000067022
Gene: ENSMUSG00000033453
AA Change: R936S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Pep_M12B_propep 24 157 8.7e-27 PFAM
Pfam:Reprolysin_4 216 422 8.2e-7 PFAM
Pfam:Reprolysin_5 217 404 7.2e-13 PFAM
Pfam:Reprolysin 218 427 3.7e-20 PFAM
Pfam:Reprolysin_3 240 372 6.1e-10 PFAM
Blast:ACR 429 507 1e-25 BLAST
TSP1 519 571 7.85e-12 SMART
Pfam:ADAM_spacer1 683 801 7.1e-36 PFAM
TSP1 842 895 3e-8 SMART
TSP1 896 949 4.21e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217070
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active versicanase enzyme. This gene is located adjacent to a related ADAMTS gene (Adamts8) on chromosome 9. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 C A 11: 110,036,439 (GRCm39) V557F possibly damaging Het
Abi3 A T 11: 95,732,851 (GRCm39) L41* probably null Het
Actn1 C A 12: 80,221,229 (GRCm39) probably null Het
Angel2 T C 1: 190,665,068 (GRCm39) S22P probably benign Het
Ank2 T G 3: 126,740,470 (GRCm39) probably benign Het
Astn1 A G 1: 158,337,563 (GRCm39) D423G probably damaging Het
Casp9 A G 4: 141,523,849 (GRCm39) D78G probably damaging Het
Cbr4 A G 8: 61,940,887 (GRCm39) D2G probably benign Het
Ccdc8 T A 7: 16,730,506 (GRCm39) L665H probably damaging Het
Cdh23 T A 10: 60,167,105 (GRCm39) N1847I probably damaging Het
Cnst T C 1: 179,437,440 (GRCm39) W335R probably benign Het
Ddr2 T A 1: 169,832,671 (GRCm39) I130F probably benign Het
Dnah2 C T 11: 69,391,665 (GRCm39) A677T probably benign Het
Dzip3 C A 16: 48,772,205 (GRCm39) W488L probably damaging Het
Ephb3 T G 16: 21,040,763 (GRCm39) I637S probably damaging Het
Etv3 A G 3: 87,436,671 (GRCm39) D142G probably benign Het
Fabp5 C T 3: 10,081,149 (GRCm39) T126I probably benign Het
Fam13b A C 18: 34,627,827 (GRCm39) Y125D probably damaging Het
Fsip2 C A 2: 82,822,471 (GRCm39) P6068Q probably damaging Het
Gm11232 A G 4: 71,674,905 (GRCm39) F199S possibly damaging Het
Gm5493 A G 17: 22,967,034 (GRCm39) K57E probably benign Het
Gm7334 A G 17: 51,006,265 (GRCm39) M184V probably benign Het
Gm9894 T C 13: 67,911,954 (GRCm39) noncoding transcript Het
Gpd2 T A 2: 57,254,525 (GRCm39) N674K probably benign Het
H2-M10.6 A G 17: 37,123,959 (GRCm39) Y141C probably damaging Het
Heatr5a C T 12: 51,931,110 (GRCm39) E1796K probably benign Het
Hexim2 A G 11: 103,029,118 (GRCm39) T57A probably benign Het
Hrg A T 16: 22,773,268 (GRCm39) N134Y probably damaging Het
Hsd17b12 T C 2: 93,864,322 (GRCm39) T262A probably damaging Het
Irak3 G T 10: 119,979,042 (GRCm39) P470T probably damaging Het
Itgbl1 A T 14: 124,083,977 (GRCm39) D285V probably damaging Het
Kcp A T 6: 29,502,863 (GRCm39) V164E probably benign Het
Klhdc7b T A 15: 89,272,589 (GRCm39) M1157K probably damaging Het
Lcor G A 19: 41,571,986 (GRCm39) G247D possibly damaging Het
Mdc1 G A 17: 36,159,525 (GRCm39) G635D probably benign Het
Mdc1 A G 17: 36,168,464 (GRCm39) K1690R probably benign Het
Mpp3 A T 11: 101,909,365 (GRCm39) probably benign Het
Ncor2 G T 5: 125,097,075 (GRCm39) H2285N probably benign Het
Neb T A 2: 52,147,839 (GRCm39) T2727S probably benign Het
Nkx6-2 T C 7: 139,161,483 (GRCm39) D234G possibly damaging Het
Nlrp9c T C 7: 26,084,150 (GRCm39) I476M probably benign Het
Nrsn1 T G 13: 25,437,355 (GRCm39) Q191P probably damaging Het
Or14j10 A T 17: 37,934,858 (GRCm39) S223T possibly damaging Het
Or1e30 C T 11: 73,678,378 (GRCm39) L205F probably benign Het
Or51ag1 T A 7: 103,156,006 (GRCm39) H49L probably benign Het
Patl1 T G 19: 11,914,718 (GRCm39) L623R probably damaging Het
Pdc T C 1: 150,209,117 (GRCm39) I200T probably benign Het
Pdzk1 A G 3: 96,775,742 (GRCm39) D370G probably benign Het
Pglyrp3 A T 3: 91,938,841 (GRCm39) I339F probably damaging Het
Plxnb1 T C 9: 108,945,679 (GRCm39) V2070A probably damaging Het
Poln G A 5: 34,266,775 (GRCm39) R461C probably damaging Het
Prl2b1 C A 13: 27,567,491 (GRCm39) V218L probably damaging Het
Pygl T C 12: 70,263,428 (GRCm39) D55G probably damaging Het
Rif1 C G 2: 51,985,856 (GRCm39) L614V probably damaging Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rsrp1 T C 4: 134,651,692 (GRCm39) F152S probably damaging Het
Sim2 T C 16: 93,898,110 (GRCm39) S115P probably damaging Het
Slc17a1 T A 13: 24,059,593 (GRCm39) I108K possibly damaging Het
Slc30a8 A G 15: 52,189,054 (GRCm39) D223G probably damaging Het
Slc39a4 A T 15: 76,500,342 (GRCm39) N69K probably benign Het
Slc51a T G 16: 32,298,584 (GRCm39) T58P probably damaging Het
Slc7a14 T C 3: 31,278,261 (GRCm39) H448R probably benign Het
Smc3 G A 19: 53,613,594 (GRCm39) probably null Het
Sox6 A T 7: 115,085,863 (GRCm39) D659E probably damaging Het
Stard9 GCCC GCC 2: 120,524,196 (GRCm39) probably null Het
Tsr1 C T 11: 74,791,119 (GRCm39) probably null Het
Ttc12 T C 9: 49,354,422 (GRCm39) K565E probably damaging Het
Ube4b A T 4: 149,452,768 (GRCm39) V386E probably benign Het
Ush2a T A 1: 188,460,293 (GRCm39) probably null Het
Usp5 C A 6: 124,794,576 (GRCm39) probably benign Het
Vmn1r216 T C 13: 23,284,105 (GRCm39) F263L probably benign Het
Vmn2r88 T A 14: 51,655,606 (GRCm39) L606* probably null Het
Wee2 T A 6: 40,426,554 (GRCm39) probably null Het
Zfhx3 T C 8: 109,519,159 (GRCm39) Y94H probably damaging Het
Zfp385c G A 11: 100,523,594 (GRCm39) P120L probably benign Het
Zscan4-ps3 T C 7: 11,344,228 (GRCm39) F62S probably damaging Het
Other mutations in Adamts15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Adamts15 APN 9 30,813,349 (GRCm39) missense probably damaging 1.00
IGL01325:Adamts15 APN 9 30,832,984 (GRCm39) missense possibly damaging 0.86
IGL01506:Adamts15 APN 9 30,833,430 (GRCm39) missense probably benign 0.08
IGL01897:Adamts15 APN 9 30,813,448 (GRCm39) missense probably damaging 1.00
IGL02137:Adamts15 APN 9 30,821,956 (GRCm39) missense probably damaging 1.00
IGL02876:Adamts15 APN 9 30,815,818 (GRCm39) missense probably damaging 0.98
IGL02997:Adamts15 APN 9 30,817,353 (GRCm39) splice site probably benign
IGL03094:Adamts15 APN 9 30,815,768 (GRCm39) splice site probably benign
IGL03146:Adamts15 APN 9 30,832,863 (GRCm39) missense probably damaging 0.99
IGL03241:Adamts15 APN 9 30,815,781 (GRCm39) missense probably damaging 1.00
Awareness UTSW 9 30,822,404 (GRCm39) critical splice donor site probably null
heightened UTSW 9 30,816,066 (GRCm39) missense probably damaging 1.00
Pugsley UTSW 9 30,817,454 (GRCm39) missense probably damaging 1.00
sparticus UTSW 9 30,821,898 (GRCm39) missense probably benign 0.40
R0118:Adamts15 UTSW 9 30,823,040 (GRCm39) missense probably damaging 1.00
R0635:Adamts15 UTSW 9 30,816,066 (GRCm39) missense probably damaging 1.00
R0827:Adamts15 UTSW 9 30,832,776 (GRCm39) missense probably damaging 1.00
R0946:Adamts15 UTSW 9 30,813,493 (GRCm39) missense probably damaging 1.00
R1608:Adamts15 UTSW 9 30,813,775 (GRCm39) missense probably damaging 0.99
R1806:Adamts15 UTSW 9 30,816,111 (GRCm39) missense probably damaging 1.00
R1954:Adamts15 UTSW 9 30,822,004 (GRCm39) missense probably benign
R1967:Adamts15 UTSW 9 30,832,605 (GRCm39) nonsense probably null
R2009:Adamts15 UTSW 9 30,833,433 (GRCm39) missense probably benign 0.17
R2129:Adamts15 UTSW 9 30,815,799 (GRCm39) missense probably benign 0.05
R2329:Adamts15 UTSW 9 30,813,781 (GRCm39) missense probably damaging 1.00
R2991:Adamts15 UTSW 9 30,832,690 (GRCm39) missense probably benign
R3970:Adamts15 UTSW 9 30,821,898 (GRCm39) missense probably benign 0.40
R4212:Adamts15 UTSW 9 30,817,470 (GRCm39) missense probably damaging 0.99
R4326:Adamts15 UTSW 9 30,815,814 (GRCm39) missense probably benign
R4329:Adamts15 UTSW 9 30,815,814 (GRCm39) missense probably benign
R4594:Adamts15 UTSW 9 30,832,743 (GRCm39) missense probably damaging 0.99
R5110:Adamts15 UTSW 9 30,832,740 (GRCm39) missense probably benign 0.01
R5120:Adamts15 UTSW 9 30,832,872 (GRCm39) missense probably damaging 1.00
R5697:Adamts15 UTSW 9 30,823,090 (GRCm39) missense probably damaging 1.00
R5901:Adamts15 UTSW 9 30,813,786 (GRCm39) missense probably damaging 1.00
R6011:Adamts15 UTSW 9 30,814,082 (GRCm39) missense probably damaging 0.98
R6651:Adamts15 UTSW 9 30,833,448 (GRCm39) missense probably damaging 0.98
R6665:Adamts15 UTSW 9 30,815,775 (GRCm39) critical splice donor site probably null
R7021:Adamts15 UTSW 9 30,832,776 (GRCm39) missense probably damaging 1.00
R7231:Adamts15 UTSW 9 30,817,454 (GRCm39) missense probably damaging 1.00
R7290:Adamts15 UTSW 9 30,813,906 (GRCm39) missense probably benign 0.05
R7390:Adamts15 UTSW 9 30,822,404 (GRCm39) critical splice donor site probably null
R7798:Adamts15 UTSW 9 30,815,939 (GRCm39) missense probably damaging 1.00
R7833:Adamts15 UTSW 9 30,833,401 (GRCm39) missense probably benign
R7908:Adamts15 UTSW 9 30,813,522 (GRCm39) missense probably benign
R8175:Adamts15 UTSW 9 30,815,952 (GRCm39) missense probably damaging 1.00
R8177:Adamts15 UTSW 9 30,833,322 (GRCm39) missense probably damaging 1.00
R8347:Adamts15 UTSW 9 30,813,846 (GRCm39) missense probably benign 0.07
R8348:Adamts15 UTSW 9 30,813,846 (GRCm39) missense probably benign 0.07
R8374:Adamts15 UTSW 9 30,814,002 (GRCm39) missense probably benign 0.21
R8473:Adamts15 UTSW 9 30,816,085 (GRCm39) missense probably damaging 1.00
R8680:Adamts15 UTSW 9 30,823,055 (GRCm39) missense possibly damaging 0.57
R9113:Adamts15 UTSW 9 30,822,498 (GRCm39) missense probably damaging 1.00
R9336:Adamts15 UTSW 9 30,816,085 (GRCm39) missense probably damaging 1.00
R9381:Adamts15 UTSW 9 30,813,816 (GRCm39) missense probably damaging 0.99
X0063:Adamts15 UTSW 9 30,833,526 (GRCm39) missense possibly damaging 0.96
X0067:Adamts15 UTSW 9 30,832,878 (GRCm39) missense probably damaging 1.00
Z1176:Adamts15 UTSW 9 30,821,996 (GRCm39) missense probably damaging 1.00
Z1177:Adamts15 UTSW 9 30,813,787 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTGTGCATTAGTTAACTTCCC -3'
(R):5'- TAGACCATCGGCCATTGGAG -3'

Sequencing Primer
(F):5'- TGCCCAGTCCAAGGAGG -3'
(R):5'- CCATTGGAGAAGCGAGCCTG -3'
Posted On 2017-06-26