Mutagenetix > Incidental Mutation

Incidental Mutation 'R6020:Adamts15'

478870

Institutional Source

Beutler Lab

Gene Symbol

Adamts15

Ensembl Gene

ENSMUSG00000033453

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 15

Synonyms

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6020 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

30899155-30922452 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 30902062 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 936 (R936S)

Ref Sequence

ENSEMBL: ENSMUSP00000067022 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065112]

AlphaFold

P59384

Predicted Effect

probably benign
Transcript: ENSMUST00000065112
AA Change: R936S

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000067022
Gene: ENSMUSG00000033453
AA Change: R936S

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:Pep_M12B_propep	24	157	8.7e-27	PFAM
Pfam:Reprolysin_4	216	422	8.2e-7	PFAM
Pfam:Reprolysin_5	217	404	7.2e-13	PFAM
Pfam:Reprolysin	218	427	3.7e-20	PFAM
Pfam:Reprolysin_3	240	372	6.1e-10	PFAM
Blast:ACR	429	507	1e-25	BLAST
TSP1	519	571	7.85e-12	SMART
Pfam:ADAM_spacer1	683	801	7.1e-36	PFAM
TSP1	842	895	3e-8	SMART
TSP1	896	949	4.21e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217070

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active versicanase enzyme. This gene is located adjacent to a related ADAMTS gene (Adamts8) on chromosome 9. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	C	A	11: 110,145,613	V557F	possibly damaging	Het
Abi3	A	T	11: 95,842,025	L41*	probably null	Het
Actn1	C	A	12: 80,174,455		probably null	Het
Angel2	T	C	1: 190,932,871	S22P	probably benign	Het
Ank2	T	G	3: 126,946,821		probably benign	Het
Astn1	A	G	1: 158,509,993	D423G	probably damaging	Het
Casp9	A	G	4: 141,796,538	D78G	probably damaging	Het
Cbr4	A	G	8: 61,487,853	D2G	probably benign	Het
Ccdc8	T	A	7: 16,996,581	L665H	probably damaging	Het
Cdh23	T	A	10: 60,331,326	N1847I	probably damaging	Het
Cnst	T	C	1: 179,609,875	W335R	probably benign	Het
Ddr2	T	A	1: 170,005,102	I130F	probably benign	Het
Dnah2	C	T	11: 69,500,839	A677T	probably benign	Het
Dzip3	C	A	16: 48,951,842	W488L	probably damaging	Het
Ephb3	T	G	16: 21,222,013	I637S	probably damaging	Het
Etv3	A	G	3: 87,529,364	D142G	probably benign	Het
Fabp5	C	T	3: 10,016,089	T126I	probably benign	Het
Fam13b	A	C	18: 34,494,774	Y125D	probably damaging	Het
Fsip2	C	A	2: 82,992,127	P6068Q	probably damaging	Het
Gm11232	A	G	4: 71,756,668	F199S	possibly damaging	Het
Gm340	G	A	19: 41,583,547	G247D	possibly damaging	Het
Gm5493	A	G	17: 22,748,061	K57E	probably benign	Het
Gm7334	A	G	17: 50,699,237	M184V	probably benign	Het
Gm9894	T	C	13: 67,763,835		noncoding transcript	Het
Gpd2	T	A	2: 57,364,513	N674K	probably benign	Het
H2-M10.6	A	G	17: 36,813,067	Y141C	probably damaging	Het
Heatr5a	C	T	12: 51,884,327	E1796K	probably benign	Het
Hexim2	A	G	11: 103,138,292	T57A	probably benign	Het
Hrg	A	T	16: 22,954,518	N134Y	probably damaging	Het
Hsd17b12	T	C	2: 94,033,977	T262A	probably damaging	Het
Irak3	G	T	10: 120,143,137	P470T	probably damaging	Het
Itgbl1	A	T	14: 123,846,565	D285V	probably damaging	Het
Kcp	A	T	6: 29,502,864	V164E	probably benign	Het
Klhdc7b	T	A	15: 89,388,386	M1157K	probably damaging	Het
Mdc1	G	A	17: 35,848,633	G635D	probably benign	Het
Mdc1	A	G	17: 35,857,572	K1690R	probably benign	Het
Mpp3	A	T	11: 102,018,539		probably benign	Het
Ncor2	G	T	5: 125,020,011	H2285N	probably benign	Het
Neb	T	A	2: 52,257,827	T2727S	probably benign	Het
Nkx6-2	T	C	7: 139,581,567	D234G	possibly damaging	Het
Nlrp9c	T	C	7: 26,384,725	I476M	probably benign	Het
Nrsn1	T	G	13: 25,253,372	Q191P	probably damaging	Het
Olfr116	A	T	17: 37,623,967	S223T	possibly damaging	Het
Olfr390	C	T	11: 73,787,552	L205F	probably benign	Het
Olfr610	T	A	7: 103,506,799	H49L	probably benign	Het
Patl1	T	G	19: 11,937,354	L623R	probably damaging	Het
Pdc	T	C	1: 150,333,366	I200T	probably benign	Het
Pdzk1	A	G	3: 96,868,426	D370G	probably benign	Het
Pglyrp3	A	T	3: 92,031,534	I339F	probably damaging	Het
Plxnb1	T	C	9: 109,116,611	V2070A	probably damaging	Het
Poln	G	A	5: 34,109,431	R461C	probably damaging	Het
Prl2b1	C	A	13: 27,383,508	V218L	probably damaging	Het
Pygl	T	C	12: 70,216,654	D55G	probably damaging	Het
Rif1	C	G	2: 52,095,844	L614V	probably damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
RP24-351P7.8	T	C	7: 11,610,301	F62S	probably damaging	Het
Rsrp1	T	C	4: 134,924,381	F152S	probably damaging	Het
Sim2	T	C	16: 94,097,251	S115P	probably damaging	Het
Slc17a1	T	A	13: 23,875,610	I108K	possibly damaging	Het
Slc30a8	A	G	15: 52,325,658	D223G	probably damaging	Het
Slc39a4	A	T	15: 76,616,142	N69K	probably benign	Het
Slc51a	T	G	16: 32,479,766	T58P	probably damaging	Het
Slc7a14	T	C	3: 31,224,112	H448R	probably benign	Het
Smc3	G	A	19: 53,625,163		probably null	Het
Sox6	A	T	7: 115,486,628	D659E	probably damaging	Het
Stard9	GCCC	GCC	2: 120,693,715		probably null	Het
Tsr1	C	T	11: 74,900,293		probably null	Het
Ttc12	T	C	9: 49,443,122	K565E	probably damaging	Het
Ube4b	A	T	4: 149,368,311	V386E	probably benign	Het
Ush2a	T	A	1: 188,728,096		probably null	Het
Usp5	C	A	6: 124,817,613		probably benign	Het
Vmn1r216	T	C	13: 23,099,935	F263L	probably benign	Het
Vmn2r88	T	A	14: 51,418,149	L606*	probably null	Het
Wee2	T	A	6: 40,449,620		probably null	Het
Zfhx3	T	C	8: 108,792,527	Y94H	probably damaging	Het
Zfp385c	G	A	11: 100,632,768	P120L	probably benign	Het

Other mutations in Adamts15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00930:Adamts15	APN	9	30902053	missense	probably damaging	1.00
IGL01325:Adamts15	APN	9	30921688	missense	possibly damaging	0.86
IGL01506:Adamts15	APN	9	30922134	missense	probably benign	0.08
IGL01897:Adamts15	APN	9	30902152	missense	probably damaging	1.00
IGL02137:Adamts15	APN	9	30910660	missense	probably damaging	1.00
IGL02876:Adamts15	APN	9	30904522	missense	probably damaging	0.98
IGL02997:Adamts15	APN	9	30906057	splice site	probably benign
IGL03094:Adamts15	APN	9	30904472	splice site	probably benign
IGL03146:Adamts15	APN	9	30921567	missense	probably damaging	0.99
IGL03241:Adamts15	APN	9	30904485	missense	probably damaging	1.00
Awareness	UTSW	9	30911108	critical splice donor site	probably null
heightened	UTSW	9	30904770	missense	probably damaging	1.00
Pugsley	UTSW	9	30906158	missense	probably damaging	1.00
sparticus	UTSW	9	30910602	missense	probably benign	0.40
R0118:Adamts15	UTSW	9	30911744	missense	probably damaging	1.00
R0635:Adamts15	UTSW	9	30904770	missense	probably damaging	1.00
R0827:Adamts15	UTSW	9	30921480	missense	probably damaging	1.00
R0946:Adamts15	UTSW	9	30902197	missense	probably damaging	1.00
R1608:Adamts15	UTSW	9	30902479	missense	probably damaging	0.99
R1806:Adamts15	UTSW	9	30904815	missense	probably damaging	1.00
R1954:Adamts15	UTSW	9	30910708	missense	probably benign
R1967:Adamts15	UTSW	9	30921309	nonsense	probably null
R2009:Adamts15	UTSW	9	30922137	missense	probably benign	0.17
R2129:Adamts15	UTSW	9	30904503	missense	probably benign	0.05
R2329:Adamts15	UTSW	9	30902485	missense	probably damaging	1.00
R2991:Adamts15	UTSW	9	30921394	missense	probably benign
R3970:Adamts15	UTSW	9	30910602	missense	probably benign	0.40
R4212:Adamts15	UTSW	9	30906174	missense	probably damaging	0.99
R4326:Adamts15	UTSW	9	30904518	missense	probably benign
R4329:Adamts15	UTSW	9	30904518	missense	probably benign
R4594:Adamts15	UTSW	9	30921447	missense	probably damaging	0.99
R5110:Adamts15	UTSW	9	30921444	missense	probably benign	0.01
R5120:Adamts15	UTSW	9	30921576	missense	probably damaging	1.00
R5697:Adamts15	UTSW	9	30911794	missense	probably damaging	1.00
R5901:Adamts15	UTSW	9	30902490	missense	probably damaging	1.00
R6011:Adamts15	UTSW	9	30902786	missense	probably damaging	0.98
R6651:Adamts15	UTSW	9	30922152	missense	probably damaging	0.98
R6665:Adamts15	UTSW	9	30904479	critical splice donor site	probably null
R7021:Adamts15	UTSW	9	30921480	missense	probably damaging	1.00
R7231:Adamts15	UTSW	9	30906158	missense	probably damaging	1.00
R7290:Adamts15	UTSW	9	30902610	missense	probably benign	0.05
R7390:Adamts15	UTSW	9	30911108	critical splice donor site	probably null
R7798:Adamts15	UTSW	9	30904643	missense	probably damaging	1.00
R7833:Adamts15	UTSW	9	30922105	missense	probably benign
R7908:Adamts15	UTSW	9	30902226	missense	probably benign
R8175:Adamts15	UTSW	9	30904656	missense	probably damaging	1.00
R8177:Adamts15	UTSW	9	30922026	missense	probably damaging	1.00
R8347:Adamts15	UTSW	9	30902550	missense	probably benign	0.07
R8348:Adamts15	UTSW	9	30902550	missense	probably benign	0.07
R8374:Adamts15	UTSW	9	30902706	missense	probably benign	0.21
R8473:Adamts15	UTSW	9	30904789	missense	probably damaging	1.00
R8680:Adamts15	UTSW	9	30911759	missense	possibly damaging	0.57
R9113:Adamts15	UTSW	9	30911202	missense	probably damaging	1.00
R9336:Adamts15	UTSW	9	30904789	missense	probably damaging	1.00
R9381:Adamts15	UTSW	9	30902520	missense	probably damaging	0.99
X0063:Adamts15	UTSW	9	30922230	missense	possibly damaging	0.96
X0067:Adamts15	UTSW	9	30921582	missense	probably damaging	1.00
Z1176:Adamts15	UTSW	9	30910700	missense	probably damaging	1.00
Z1177:Adamts15	UTSW	9	30902491	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACTGTGCATTAGTTAACTTCCC -3'
(R):5'- TAGACCATCGGCCATTGGAG -3'

Sequencing Primer
(F):5'- TGCCCAGTCCAAGGAGG -3'
(R):5'- CCATTGGAGAAGCGAGCCTG -3'

Posted On

2017-06-26