Incidental Mutation 'R6020:Plxnb1'
ID 478872
Institutional Source Beutler Lab
Gene Symbol Plxnb1
Ensembl Gene ENSMUSG00000053646
Gene Name plexin B1
Synonyms 2900002G15Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6020 (G1)
Quality Score 222.009
Status Not validated
Chromosome 9
Chromosomal Location 108924457-108948985 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 108945679 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 2070 (V2070A)
Ref Sequence ENSEMBL: ENSMUSP00000071966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072093]
AlphaFold Q8CJH3
Predicted Effect probably damaging
Transcript: ENSMUST00000072093
AA Change: V2070A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000071966
Gene: ENSMUSG00000053646
AA Change: V2070A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 35 463 5.84e-101 SMART
PSI 481 534 1.17e-13 SMART
PSI 628 678 6.97e-3 SMART
low complexity region 691 706 N/A INTRINSIC
low complexity region 752 771 N/A INTRINSIC
PSI 1019 1066 2.06e-5 SMART
IPT 1067 1158 7.48e-18 SMART
IPT 1159 1247 3.97e-22 SMART
IPT 1249 1359 6.09e-9 SMART
low complexity region 1483 1494 N/A INTRINSIC
Pfam:Plexin_cytopl 1546 2086 6.5e-230 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutants are viable and fertile and show no apparent defects in development, adult histology or basic functional parameters. However, a transitory renal phenotype, characterized by increased ureteric branching and enlarged kidneys, is noted over early stages of renal development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 C A 11: 110,036,439 (GRCm39) V557F possibly damaging Het
Abi3 A T 11: 95,732,851 (GRCm39) L41* probably null Het
Actn1 C A 12: 80,221,229 (GRCm39) probably null Het
Adamts15 G T 9: 30,813,358 (GRCm39) R936S probably benign Het
Angel2 T C 1: 190,665,068 (GRCm39) S22P probably benign Het
Ank2 T G 3: 126,740,470 (GRCm39) probably benign Het
Astn1 A G 1: 158,337,563 (GRCm39) D423G probably damaging Het
Casp9 A G 4: 141,523,849 (GRCm39) D78G probably damaging Het
Cbr4 A G 8: 61,940,887 (GRCm39) D2G probably benign Het
Ccdc8 T A 7: 16,730,506 (GRCm39) L665H probably damaging Het
Cdh23 T A 10: 60,167,105 (GRCm39) N1847I probably damaging Het
Cnst T C 1: 179,437,440 (GRCm39) W335R probably benign Het
Ddr2 T A 1: 169,832,671 (GRCm39) I130F probably benign Het
Dnah2 C T 11: 69,391,665 (GRCm39) A677T probably benign Het
Dzip3 C A 16: 48,772,205 (GRCm39) W488L probably damaging Het
Ephb3 T G 16: 21,040,763 (GRCm39) I637S probably damaging Het
Etv3 A G 3: 87,436,671 (GRCm39) D142G probably benign Het
Fabp5 C T 3: 10,081,149 (GRCm39) T126I probably benign Het
Fam13b A C 18: 34,627,827 (GRCm39) Y125D probably damaging Het
Fsip2 C A 2: 82,822,471 (GRCm39) P6068Q probably damaging Het
Gm11232 A G 4: 71,674,905 (GRCm39) F199S possibly damaging Het
Gm5493 A G 17: 22,967,034 (GRCm39) K57E probably benign Het
Gm7334 A G 17: 51,006,265 (GRCm39) M184V probably benign Het
Gm9894 T C 13: 67,911,954 (GRCm39) noncoding transcript Het
Gpd2 T A 2: 57,254,525 (GRCm39) N674K probably benign Het
H2-M10.6 A G 17: 37,123,959 (GRCm39) Y141C probably damaging Het
Heatr5a C T 12: 51,931,110 (GRCm39) E1796K probably benign Het
Hexim2 A G 11: 103,029,118 (GRCm39) T57A probably benign Het
Hrg A T 16: 22,773,268 (GRCm39) N134Y probably damaging Het
Hsd17b12 T C 2: 93,864,322 (GRCm39) T262A probably damaging Het
Irak3 G T 10: 119,979,042 (GRCm39) P470T probably damaging Het
Itgbl1 A T 14: 124,083,977 (GRCm39) D285V probably damaging Het
Kcp A T 6: 29,502,863 (GRCm39) V164E probably benign Het
Klhdc7b T A 15: 89,272,589 (GRCm39) M1157K probably damaging Het
Lcor G A 19: 41,571,986 (GRCm39) G247D possibly damaging Het
Mdc1 G A 17: 36,159,525 (GRCm39) G635D probably benign Het
Mdc1 A G 17: 36,168,464 (GRCm39) K1690R probably benign Het
Mpp3 A T 11: 101,909,365 (GRCm39) probably benign Het
Ncor2 G T 5: 125,097,075 (GRCm39) H2285N probably benign Het
Neb T A 2: 52,147,839 (GRCm39) T2727S probably benign Het
Nkx6-2 T C 7: 139,161,483 (GRCm39) D234G possibly damaging Het
Nlrp9c T C 7: 26,084,150 (GRCm39) I476M probably benign Het
Nrsn1 T G 13: 25,437,355 (GRCm39) Q191P probably damaging Het
Or14j10 A T 17: 37,934,858 (GRCm39) S223T possibly damaging Het
Or1e30 C T 11: 73,678,378 (GRCm39) L205F probably benign Het
Or51ag1 T A 7: 103,156,006 (GRCm39) H49L probably benign Het
Patl1 T G 19: 11,914,718 (GRCm39) L623R probably damaging Het
Pdc T C 1: 150,209,117 (GRCm39) I200T probably benign Het
Pdzk1 A G 3: 96,775,742 (GRCm39) D370G probably benign Het
Pglyrp3 A T 3: 91,938,841 (GRCm39) I339F probably damaging Het
Poln G A 5: 34,266,775 (GRCm39) R461C probably damaging Het
Prl2b1 C A 13: 27,567,491 (GRCm39) V218L probably damaging Het
Pygl T C 12: 70,263,428 (GRCm39) D55G probably damaging Het
Rif1 C G 2: 51,985,856 (GRCm39) L614V probably damaging Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rsrp1 T C 4: 134,651,692 (GRCm39) F152S probably damaging Het
Sim2 T C 16: 93,898,110 (GRCm39) S115P probably damaging Het
Slc17a1 T A 13: 24,059,593 (GRCm39) I108K possibly damaging Het
Slc30a8 A G 15: 52,189,054 (GRCm39) D223G probably damaging Het
Slc39a4 A T 15: 76,500,342 (GRCm39) N69K probably benign Het
Slc51a T G 16: 32,298,584 (GRCm39) T58P probably damaging Het
Slc7a14 T C 3: 31,278,261 (GRCm39) H448R probably benign Het
Smc3 G A 19: 53,613,594 (GRCm39) probably null Het
Sox6 A T 7: 115,085,863 (GRCm39) D659E probably damaging Het
Stard9 GCCC GCC 2: 120,524,196 (GRCm39) probably null Het
Tsr1 C T 11: 74,791,119 (GRCm39) probably null Het
Ttc12 T C 9: 49,354,422 (GRCm39) K565E probably damaging Het
Ube4b A T 4: 149,452,768 (GRCm39) V386E probably benign Het
Ush2a T A 1: 188,460,293 (GRCm39) probably null Het
Usp5 C A 6: 124,794,576 (GRCm39) probably benign Het
Vmn1r216 T C 13: 23,284,105 (GRCm39) F263L probably benign Het
Vmn2r88 T A 14: 51,655,606 (GRCm39) L606* probably null Het
Wee2 T A 6: 40,426,554 (GRCm39) probably null Het
Zfhx3 T C 8: 109,519,159 (GRCm39) Y94H probably damaging Het
Zfp385c G A 11: 100,523,594 (GRCm39) P120L probably benign Het
Zscan4-ps3 T C 7: 11,344,228 (GRCm39) F62S probably damaging Het
Other mutations in Plxnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Plxnb1 APN 9 108,942,936 (GRCm39) missense probably benign 0.04
IGL01014:Plxnb1 APN 9 108,935,102 (GRCm39) missense probably benign 0.00
IGL01142:Plxnb1 APN 9 108,931,765 (GRCm39) missense probably benign 0.05
IGL01454:Plxnb1 APN 9 108,942,422 (GRCm39) missense probably damaging 1.00
IGL01469:Plxnb1 APN 9 108,934,483 (GRCm39) intron probably benign
IGL01530:Plxnb1 APN 9 108,939,473 (GRCm39) missense probably benign 0.02
IGL01599:Plxnb1 APN 9 108,939,672 (GRCm39) missense probably damaging 1.00
IGL01968:Plxnb1 APN 9 108,930,052 (GRCm39) missense probably benign 0.00
IGL02175:Plxnb1 APN 9 108,929,914 (GRCm39) missense possibly damaging 0.85
IGL02216:Plxnb1 APN 9 108,929,918 (GRCm39) missense probably damaging 1.00
IGL02277:Plxnb1 APN 9 108,941,201 (GRCm39) missense probably damaging 1.00
IGL02311:Plxnb1 APN 9 108,930,190 (GRCm39) missense probably benign
IGL02645:Plxnb1 APN 9 108,943,311 (GRCm39) splice site probably benign
IGL03076:Plxnb1 APN 9 108,935,970 (GRCm39) missense probably damaging 0.96
IGL03107:Plxnb1 APN 9 108,934,054 (GRCm39) missense probably benign
IGL03343:Plxnb1 APN 9 108,943,780 (GRCm39) missense probably damaging 1.00
PIT4431001:Plxnb1 UTSW 9 108,929,786 (GRCm39) missense probably damaging 1.00
R0117:Plxnb1 UTSW 9 108,934,286 (GRCm39) missense possibly damaging 0.93
R0211:Plxnb1 UTSW 9 108,932,731 (GRCm39) nonsense probably null
R0211:Plxnb1 UTSW 9 108,932,731 (GRCm39) nonsense probably null
R0843:Plxnb1 UTSW 9 108,942,769 (GRCm39) missense probably benign 0.20
R0970:Plxnb1 UTSW 9 108,932,331 (GRCm39) missense probably damaging 1.00
R0973:Plxnb1 UTSW 9 108,931,210 (GRCm39) missense possibly damaging 0.47
R1342:Plxnb1 UTSW 9 108,929,720 (GRCm39) missense possibly damaging 0.87
R1386:Plxnb1 UTSW 9 108,930,091 (GRCm39) missense probably benign 0.27
R1419:Plxnb1 UTSW 9 108,943,454 (GRCm39) missense probably damaging 1.00
R1445:Plxnb1 UTSW 9 108,937,989 (GRCm39) missense probably null
R1548:Plxnb1 UTSW 9 108,929,968 (GRCm39) missense possibly damaging 0.95
R1621:Plxnb1 UTSW 9 108,935,873 (GRCm39) missense probably benign 0.04
R1658:Plxnb1 UTSW 9 108,931,939 (GRCm39) nonsense probably null
R1727:Plxnb1 UTSW 9 108,930,125 (GRCm39) splice site probably null
R1750:Plxnb1 UTSW 9 108,940,836 (GRCm39) missense probably benign 0.00
R1795:Plxnb1 UTSW 9 108,929,813 (GRCm39) missense probably benign
R1929:Plxnb1 UTSW 9 108,931,776 (GRCm39) splice site probably null
R1935:Plxnb1 UTSW 9 108,924,715 (GRCm39) critical splice donor site probably null
R1936:Plxnb1 UTSW 9 108,924,715 (GRCm39) critical splice donor site probably null
R2014:Plxnb1 UTSW 9 108,935,687 (GRCm39) splice site probably benign
R2057:Plxnb1 UTSW 9 108,938,294 (GRCm39) missense possibly damaging 0.71
R2102:Plxnb1 UTSW 9 108,944,810 (GRCm39) missense probably damaging 1.00
R2271:Plxnb1 UTSW 9 108,931,776 (GRCm39) splice site probably null
R2422:Plxnb1 UTSW 9 108,937,506 (GRCm39) missense probably benign 0.02
R2881:Plxnb1 UTSW 9 108,943,480 (GRCm39) missense probably damaging 1.00
R3409:Plxnb1 UTSW 9 108,935,681 (GRCm39) splice site probably null
R3417:Plxnb1 UTSW 9 108,929,828 (GRCm39) missense probably damaging 0.97
R3756:Plxnb1 UTSW 9 108,942,526 (GRCm39) unclassified probably benign
R3788:Plxnb1 UTSW 9 108,938,355 (GRCm39) missense possibly damaging 0.89
R3789:Plxnb1 UTSW 9 108,938,355 (GRCm39) missense possibly damaging 0.89
R4042:Plxnb1 UTSW 9 108,934,241 (GRCm39) missense probably benign 0.00
R4289:Plxnb1 UTSW 9 108,943,420 (GRCm39) missense probably damaging 1.00
R4396:Plxnb1 UTSW 9 108,929,291 (GRCm39) missense possibly damaging 0.51
R4564:Plxnb1 UTSW 9 108,942,488 (GRCm39) missense probably benign 0.10
R4676:Plxnb1 UTSW 9 108,939,503 (GRCm39) missense possibly damaging 0.63
R4706:Plxnb1 UTSW 9 108,941,096 (GRCm39) missense probably damaging 1.00
R4792:Plxnb1 UTSW 9 108,939,716 (GRCm39) missense probably damaging 1.00
R4796:Plxnb1 UTSW 9 108,943,663 (GRCm39) missense probably damaging 1.00
R4835:Plxnb1 UTSW 9 108,934,442 (GRCm39) missense probably damaging 0.96
R4901:Plxnb1 UTSW 9 108,934,027 (GRCm39) missense probably benign 0.01
R4952:Plxnb1 UTSW 9 108,943,904 (GRCm39) missense probably damaging 1.00
R5005:Plxnb1 UTSW 9 108,935,647 (GRCm39) missense probably benign 0.00
R5015:Plxnb1 UTSW 9 108,929,498 (GRCm39) missense possibly damaging 0.95
R5029:Plxnb1 UTSW 9 108,943,723 (GRCm39) missense probably damaging 1.00
R5180:Plxnb1 UTSW 9 108,940,761 (GRCm39) splice site probably null
R5256:Plxnb1 UTSW 9 108,943,661 (GRCm39) missense probably damaging 1.00
R5285:Plxnb1 UTSW 9 108,937,527 (GRCm39) missense probably damaging 0.99
R5431:Plxnb1 UTSW 9 108,929,840 (GRCm39) missense probably damaging 1.00
R5444:Plxnb1 UTSW 9 108,935,521 (GRCm39) missense probably benign 0.22
R5546:Plxnb1 UTSW 9 108,929,818 (GRCm39) missense probably damaging 1.00
R5852:Plxnb1 UTSW 9 108,935,518 (GRCm39) missense probably damaging 1.00
R5892:Plxnb1 UTSW 9 108,940,775 (GRCm39) missense probably damaging 1.00
R6053:Plxnb1 UTSW 9 108,940,775 (GRCm39) missense probably damaging 1.00
R6177:Plxnb1 UTSW 9 108,931,993 (GRCm39) splice site probably null
R6193:Plxnb1 UTSW 9 108,933,971 (GRCm39) missense probably benign
R6274:Plxnb1 UTSW 9 108,941,209 (GRCm39) critical splice donor site probably null
R6310:Plxnb1 UTSW 9 108,938,796 (GRCm39) missense probably damaging 0.96
R6404:Plxnb1 UTSW 9 108,945,705 (GRCm39) missense probably damaging 1.00
R6422:Plxnb1 UTSW 9 108,937,992 (GRCm39) missense probably damaging 1.00
R6479:Plxnb1 UTSW 9 108,940,733 (GRCm39) missense possibly damaging 0.92
R6555:Plxnb1 UTSW 9 108,937,473 (GRCm39) critical splice acceptor site probably null
R6646:Plxnb1 UTSW 9 108,937,895 (GRCm39) missense probably benign
R6648:Plxnb1 UTSW 9 108,933,398 (GRCm39) missense probably benign 0.14
R6661:Plxnb1 UTSW 9 108,933,367 (GRCm39) missense possibly damaging 0.94
R6674:Plxnb1 UTSW 9 108,937,214 (GRCm39) missense probably benign 0.00
R6734:Plxnb1 UTSW 9 108,937,988 (GRCm39) nonsense probably null
R6859:Plxnb1 UTSW 9 108,935,838 (GRCm39) missense probably damaging 1.00
R6948:Plxnb1 UTSW 9 108,945,702 (GRCm39) missense probably damaging 0.96
R7030:Plxnb1 UTSW 9 108,941,375 (GRCm39) missense probably damaging 1.00
R7038:Plxnb1 UTSW 9 108,929,453 (GRCm39) missense probably damaging 1.00
R7204:Plxnb1 UTSW 9 108,929,243 (GRCm39) missense probably damaging 1.00
R7427:Plxnb1 UTSW 9 108,937,236 (GRCm39) missense probably benign 0.01
R7428:Plxnb1 UTSW 9 108,937,236 (GRCm39) missense probably benign 0.01
R7443:Plxnb1 UTSW 9 108,943,675 (GRCm39) missense probably damaging 1.00
R7527:Plxnb1 UTSW 9 108,929,929 (GRCm39) missense probably damaging 0.99
R7645:Plxnb1 UTSW 9 108,943,480 (GRCm39) missense probably damaging 1.00
R7680:Plxnb1 UTSW 9 108,929,571 (GRCm39) nonsense probably null
R7866:Plxnb1 UTSW 9 108,929,525 (GRCm39) missense probably damaging 0.98
R7898:Plxnb1 UTSW 9 108,943,408 (GRCm39) missense probably damaging 1.00
R7905:Plxnb1 UTSW 9 108,938,300 (GRCm39) missense probably damaging 1.00
R8092:Plxnb1 UTSW 9 108,929,573 (GRCm39) missense probably damaging 1.00
R8150:Plxnb1 UTSW 9 108,941,146 (GRCm39) missense probably damaging 0.98
R8286:Plxnb1 UTSW 9 108,935,870 (GRCm39) missense probably damaging 1.00
R8290:Plxnb1 UTSW 9 108,938,687 (GRCm39) missense probably benign 0.00
R8987:Plxnb1 UTSW 9 108,937,178 (GRCm39) splice site probably benign
R9176:Plxnb1 UTSW 9 108,941,651 (GRCm39) missense probably damaging 1.00
R9231:Plxnb1 UTSW 9 108,934,286 (GRCm39) missense possibly damaging 0.59
R9698:Plxnb1 UTSW 9 108,925,251 (GRCm39) start gained probably benign
Z1177:Plxnb1 UTSW 9 108,937,989 (GRCm39) missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- CCTACTATGGAGGTTTGGCC -3'
(R):5'- TGACAGATTCTCCAGATGCC -3'

Sequencing Primer
(F):5'- GCCTTGTCCCGTCCTGAG -3'
(R):5'- GATTCTCCAGATGCCCCCAAC -3'
Posted On 2017-06-26