Mutagenetix > Incidental Mutation

Incidental Mutation 'R6020:Plxnb1'

478872

Institutional Source

Beutler Lab

Gene Symbol

Plxnb1

Ensembl Gene

ENSMUSG00000053646

Gene Name

plexin B1

Synonyms

2900002G15Rik

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6020 (G1)

Quality Score

222.009

Status

Not validated

Chromosome

Chromosomal Location

109095389-109119917 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 109116611 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 2070 (V2070A)

Ref Sequence

ENSEMBL: ENSMUSP00000071966 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072093]

AlphaFold

Q8CJH3

Predicted Effect

probably damaging
Transcript: ENSMUST00000072093
AA Change: V2070A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000071966
Gene: ENSMUSG00000053646
AA Change: V2070A

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Sema	35	463	5.84e-101	SMART
PSI	481	534	1.17e-13	SMART
PSI	628	678	6.97e-3	SMART
low complexity region	691	706	N/A	INTRINSIC
low complexity region	752	771	N/A	INTRINSIC
PSI	1019	1066	2.06e-5	SMART
IPT	1067	1158	7.48e-18	SMART
IPT	1159	1247	3.97e-22	SMART
IPT	1249	1359	6.09e-9	SMART
low complexity region	1483	1494	N/A	INTRINSIC
Pfam:Plexin_cytopl	1546	2086	6.5e-230	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mutants are viable and fertile and show no apparent defects in development, adult histology or basic functional parameters. However, a transitory renal phenotype, characterized by increased ureteric branching and enlarged kidneys, is noted over early stages of renal development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	C	A	11: 110,145,613	V557F	possibly damaging	Het
Abi3	A	T	11: 95,842,025	L41*	probably null	Het
Actn1	C	A	12: 80,174,455		probably null	Het
Adamts15	G	T	9: 30,902,062	R936S	probably benign	Het
Angel2	T	C	1: 190,932,871	S22P	probably benign	Het
Ank2	T	G	3: 126,946,821		probably benign	Het
Astn1	A	G	1: 158,509,993	D423G	probably damaging	Het
Casp9	A	G	4: 141,796,538	D78G	probably damaging	Het
Cbr4	A	G	8: 61,487,853	D2G	probably benign	Het
Ccdc8	T	A	7: 16,996,581	L665H	probably damaging	Het
Cdh23	T	A	10: 60,331,326	N1847I	probably damaging	Het
Cnst	T	C	1: 179,609,875	W335R	probably benign	Het
Ddr2	T	A	1: 170,005,102	I130F	probably benign	Het
Dnah2	C	T	11: 69,500,839	A677T	probably benign	Het
Dzip3	C	A	16: 48,951,842	W488L	probably damaging	Het
Ephb3	T	G	16: 21,222,013	I637S	probably damaging	Het
Etv3	A	G	3: 87,529,364	D142G	probably benign	Het
Fabp5	C	T	3: 10,016,089	T126I	probably benign	Het
Fam13b	A	C	18: 34,494,774	Y125D	probably damaging	Het
Fsip2	C	A	2: 82,992,127	P6068Q	probably damaging	Het
Gm11232	A	G	4: 71,756,668	F199S	possibly damaging	Het
Gm340	G	A	19: 41,583,547	G247D	possibly damaging	Het
Gm5493	A	G	17: 22,748,061	K57E	probably benign	Het
Gm7334	A	G	17: 50,699,237	M184V	probably benign	Het
Gm9894	T	C	13: 67,763,835		noncoding transcript	Het
Gpd2	T	A	2: 57,364,513	N674K	probably benign	Het
H2-M10.6	A	G	17: 36,813,067	Y141C	probably damaging	Het
Heatr5a	C	T	12: 51,884,327	E1796K	probably benign	Het
Hexim2	A	G	11: 103,138,292	T57A	probably benign	Het
Hrg	A	T	16: 22,954,518	N134Y	probably damaging	Het
Hsd17b12	T	C	2: 94,033,977	T262A	probably damaging	Het
Irak3	G	T	10: 120,143,137	P470T	probably damaging	Het
Itgbl1	A	T	14: 123,846,565	D285V	probably damaging	Het
Kcp	A	T	6: 29,502,864	V164E	probably benign	Het
Klhdc7b	T	A	15: 89,388,386	M1157K	probably damaging	Het
Mdc1	G	A	17: 35,848,633	G635D	probably benign	Het
Mdc1	A	G	17: 35,857,572	K1690R	probably benign	Het
Mpp3	A	T	11: 102,018,539		probably benign	Het
Ncor2	G	T	5: 125,020,011	H2285N	probably benign	Het
Neb	T	A	2: 52,257,827	T2727S	probably benign	Het
Nkx6-2	T	C	7: 139,581,567	D234G	possibly damaging	Het
Nlrp9c	T	C	7: 26,384,725	I476M	probably benign	Het
Nrsn1	T	G	13: 25,253,372	Q191P	probably damaging	Het
Olfr116	A	T	17: 37,623,967	S223T	possibly damaging	Het
Olfr390	C	T	11: 73,787,552	L205F	probably benign	Het
Olfr610	T	A	7: 103,506,799	H49L	probably benign	Het
Patl1	T	G	19: 11,937,354	L623R	probably damaging	Het
Pdc	T	C	1: 150,333,366	I200T	probably benign	Het
Pdzk1	A	G	3: 96,868,426	D370G	probably benign	Het
Pglyrp3	A	T	3: 92,031,534	I339F	probably damaging	Het
Poln	G	A	5: 34,109,431	R461C	probably damaging	Het
Prl2b1	C	A	13: 27,383,508	V218L	probably damaging	Het
Pygl	T	C	12: 70,216,654	D55G	probably damaging	Het
Rif1	C	G	2: 52,095,844	L614V	probably damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
RP24-351P7.8	T	C	7: 11,610,301	F62S	probably damaging	Het
Rsrp1	T	C	4: 134,924,381	F152S	probably damaging	Het
Sim2	T	C	16: 94,097,251	S115P	probably damaging	Het
Slc17a1	T	A	13: 23,875,610	I108K	possibly damaging	Het
Slc30a8	A	G	15: 52,325,658	D223G	probably damaging	Het
Slc39a4	A	T	15: 76,616,142	N69K	probably benign	Het
Slc51a	T	G	16: 32,479,766	T58P	probably damaging	Het
Slc7a14	T	C	3: 31,224,112	H448R	probably benign	Het
Smc3	G	A	19: 53,625,163		probably null	Het
Sox6	A	T	7: 115,486,628	D659E	probably damaging	Het
Stard9	GCCC	GCC	2: 120,693,715		probably null	Het
Tsr1	C	T	11: 74,900,293		probably null	Het
Ttc12	T	C	9: 49,443,122	K565E	probably damaging	Het
Ube4b	A	T	4: 149,368,311	V386E	probably benign	Het
Ush2a	T	A	1: 188,728,096		probably null	Het
Usp5	C	A	6: 124,817,613		probably benign	Het
Vmn1r216	T	C	13: 23,099,935	F263L	probably benign	Het
Vmn2r88	T	A	14: 51,418,149	L606*	probably null	Het
Wee2	T	A	6: 40,449,620		probably null	Het
Zfhx3	T	C	8: 108,792,527	Y94H	probably damaging	Het
Zfp385c	G	A	11: 100,632,768	P120L	probably benign	Het

Other mutations in Plxnb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00593:Plxnb1	APN	9	109113868	missense	probably benign	0.04
IGL01014:Plxnb1	APN	9	109106034	missense	probably benign	0.00
IGL01142:Plxnb1	APN	9	109102697	missense	probably benign	0.05
IGL01454:Plxnb1	APN	9	109113354	missense	probably damaging	1.00
IGL01469:Plxnb1	APN	9	109105415	intron	probably benign
IGL01530:Plxnb1	APN	9	109110405	missense	probably benign	0.02
IGL01599:Plxnb1	APN	9	109110604	missense	probably damaging	1.00
IGL01968:Plxnb1	APN	9	109100984	missense	probably benign	0.00
IGL02175:Plxnb1	APN	9	109100846	missense	possibly damaging	0.85
IGL02216:Plxnb1	APN	9	109100850	missense	probably damaging	1.00
IGL02277:Plxnb1	APN	9	109112133	missense	probably damaging	1.00
IGL02311:Plxnb1	APN	9	109101122	missense	probably benign
IGL02645:Plxnb1	APN	9	109114243	splice site	probably benign
IGL03076:Plxnb1	APN	9	109106902	missense	probably damaging	0.96
IGL03107:Plxnb1	APN	9	109104986	missense	probably benign
IGL03343:Plxnb1	APN	9	109114712	missense	probably damaging	1.00
PIT4431001:Plxnb1	UTSW	9	109100718	missense	probably damaging	1.00
R0117:Plxnb1	UTSW	9	109105218	missense	possibly damaging	0.93
R0211:Plxnb1	UTSW	9	109103663	nonsense	probably null
R0211:Plxnb1	UTSW	9	109103663	nonsense	probably null
R0843:Plxnb1	UTSW	9	109113701	missense	probably benign	0.20
R0970:Plxnb1	UTSW	9	109103263	missense	probably damaging	1.00
R0973:Plxnb1	UTSW	9	109102142	missense	possibly damaging	0.47
R1342:Plxnb1	UTSW	9	109100652	missense	possibly damaging	0.87
R1386:Plxnb1	UTSW	9	109101023	missense	probably benign	0.27
R1419:Plxnb1	UTSW	9	109114386	missense	probably damaging	1.00
R1445:Plxnb1	UTSW	9	109108921	missense	probably null
R1548:Plxnb1	UTSW	9	109100900	missense	possibly damaging	0.95
R1621:Plxnb1	UTSW	9	109106805	missense	probably benign	0.04
R1658:Plxnb1	UTSW	9	109102871	nonsense	probably null
R1727:Plxnb1	UTSW	9	109101057	splice site	probably null
R1750:Plxnb1	UTSW	9	109111768	missense	probably benign	0.00
R1795:Plxnb1	UTSW	9	109100745	missense	probably benign
R1929:Plxnb1	UTSW	9	109102708	splice site	probably null
R1935:Plxnb1	UTSW	9	109095647	critical splice donor site	probably null
R1936:Plxnb1	UTSW	9	109095647	critical splice donor site	probably null
R2014:Plxnb1	UTSW	9	109106619	splice site	probably benign
R2057:Plxnb1	UTSW	9	109109226	missense	possibly damaging	0.71
R2102:Plxnb1	UTSW	9	109115742	missense	probably damaging	1.00
R2271:Plxnb1	UTSW	9	109102708	splice site	probably null
R2422:Plxnb1	UTSW	9	109108438	missense	probably benign	0.02
R2881:Plxnb1	UTSW	9	109114412	missense	probably damaging	1.00
R3409:Plxnb1	UTSW	9	109106613	splice site	probably null
R3417:Plxnb1	UTSW	9	109100760	missense	probably damaging	0.97
R3756:Plxnb1	UTSW	9	109113458	unclassified	probably benign
R3788:Plxnb1	UTSW	9	109109287	missense	possibly damaging	0.89
R3789:Plxnb1	UTSW	9	109109287	missense	possibly damaging	0.89
R4042:Plxnb1	UTSW	9	109105173	missense	probably benign	0.00
R4289:Plxnb1	UTSW	9	109114352	missense	probably damaging	1.00
R4396:Plxnb1	UTSW	9	109100223	missense	possibly damaging	0.51
R4564:Plxnb1	UTSW	9	109113420	missense	probably benign	0.10
R4676:Plxnb1	UTSW	9	109110435	missense	possibly damaging	0.63
R4706:Plxnb1	UTSW	9	109112028	missense	probably damaging	1.00
R4792:Plxnb1	UTSW	9	109110648	missense	probably damaging	1.00
R4796:Plxnb1	UTSW	9	109114595	missense	probably damaging	1.00
R4835:Plxnb1	UTSW	9	109105374	missense	probably damaging	0.96
R4901:Plxnb1	UTSW	9	109104959	missense	probably benign	0.01
R4952:Plxnb1	UTSW	9	109114836	missense	probably damaging	1.00
R5005:Plxnb1	UTSW	9	109106579	missense	probably benign	0.00
R5015:Plxnb1	UTSW	9	109100430	missense	possibly damaging	0.95
R5029:Plxnb1	UTSW	9	109114655	missense	probably damaging	1.00
R5180:Plxnb1	UTSW	9	109111693	splice site	probably null
R5256:Plxnb1	UTSW	9	109114593	missense	probably damaging	1.00
R5285:Plxnb1	UTSW	9	109108459	missense	probably damaging	0.99
R5431:Plxnb1	UTSW	9	109100772	missense	probably damaging	1.00
R5444:Plxnb1	UTSW	9	109106453	missense	probably benign	0.22
R5546:Plxnb1	UTSW	9	109100750	missense	probably damaging	1.00
R5852:Plxnb1	UTSW	9	109106450	missense	probably damaging	1.00
R5892:Plxnb1	UTSW	9	109111707	missense	probably damaging	1.00
R6053:Plxnb1	UTSW	9	109111707	missense	probably damaging	1.00
R6177:Plxnb1	UTSW	9	109102925	splice site	probably null
R6193:Plxnb1	UTSW	9	109104903	missense	probably benign
R6274:Plxnb1	UTSW	9	109112141	critical splice donor site	probably null
R6310:Plxnb1	UTSW	9	109109728	missense	probably damaging	0.96
R6404:Plxnb1	UTSW	9	109116637	missense	probably damaging	1.00
R6422:Plxnb1	UTSW	9	109108924	missense	probably damaging	1.00
R6479:Plxnb1	UTSW	9	109111665	missense	possibly damaging	0.92
R6555:Plxnb1	UTSW	9	109108405	critical splice acceptor site	probably null
R6646:Plxnb1	UTSW	9	109108827	missense	probably benign
R6648:Plxnb1	UTSW	9	109104330	missense	probably benign	0.14
R6661:Plxnb1	UTSW	9	109104299	missense	possibly damaging	0.94
R6674:Plxnb1	UTSW	9	109108146	missense	probably benign	0.00
R6734:Plxnb1	UTSW	9	109108920	nonsense	probably null
R6859:Plxnb1	UTSW	9	109106770	missense	probably damaging	1.00
R6948:Plxnb1	UTSW	9	109116634	missense	probably damaging	0.96
R7030:Plxnb1	UTSW	9	109112307	missense	probably damaging	1.00
R7038:Plxnb1	UTSW	9	109100385	missense	probably damaging	1.00
R7204:Plxnb1	UTSW	9	109100175	missense	probably damaging	1.00
R7427:Plxnb1	UTSW	9	109108168	missense	probably benign	0.01
R7428:Plxnb1	UTSW	9	109108168	missense	probably benign	0.01
R7443:Plxnb1	UTSW	9	109114607	missense	probably damaging	1.00
R7527:Plxnb1	UTSW	9	109100861	missense	probably damaging	0.99
R7645:Plxnb1	UTSW	9	109114412	missense	probably damaging	1.00
R7680:Plxnb1	UTSW	9	109100503	nonsense	probably null
R7866:Plxnb1	UTSW	9	109100457	missense	probably damaging	0.98
R7898:Plxnb1	UTSW	9	109114340	missense	probably damaging	1.00
R7905:Plxnb1	UTSW	9	109109232	missense	probably damaging	1.00
R8092:Plxnb1	UTSW	9	109100505	missense	probably damaging	1.00
R8150:Plxnb1	UTSW	9	109112078	missense	probably damaging	0.98
R8286:Plxnb1	UTSW	9	109106802	missense	probably damaging	1.00
R8290:Plxnb1	UTSW	9	109109619	missense	probably benign	0.00
R8987:Plxnb1	UTSW	9	109108110	splice site	probably benign
R9176:Plxnb1	UTSW	9	109112583	missense	probably damaging	1.00
R9231:Plxnb1	UTSW	9	109105218	missense	possibly damaging	0.59
R9698:Plxnb1	UTSW	9	109096183	start gained	probably benign
Z1177:Plxnb1	UTSW	9	109108921	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- CCTACTATGGAGGTTTGGCC -3'
(R):5'- TGACAGATTCTCCAGATGCC -3'

Sequencing Primer
(F):5'- GCCTTGTCCCGTCCTGAG -3'
(R):5'- GATTCTCCAGATGCCCCCAAC -3'

Posted On

2017-06-26