Incidental Mutation 'R6020:Or1e30'
ID 478876
Institutional Source Beutler Lab
Gene Symbol Or1e30
Ensembl Gene ENSMUSG00000069818
Gene Name olfactory receptor family 1 subfamily E member 30
Synonyms Olfr390, MOR135-26, GA_x6K02T2P1NL-3938806-3939741
Accession Numbers
Essential gene? Probably non essential (E-score: 0.146) question?
Stock # R6020 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 73677766-73678701 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 73678378 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 205 (L205F)
Ref Sequence ENSEMBL: ENSMUSP00000148992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092919] [ENSMUST00000120081] [ENSMUST00000206815] [ENSMUST00000215161]
AlphaFold Q8VEZ7
Predicted Effect probably benign
Transcript: ENSMUST00000092919
AA Change: L205F

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000090598
Gene: ENSMUSG00000069818
AA Change: L205F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.1e-61 PFAM
Pfam:7TM_GPCR_Srsx 35 305 7.2e-9 PFAM
Pfam:7tm_1 41 290 6.8e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120081
AA Change: L205F

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000113472
Gene: ENSMUSG00000069818
AA Change: L205F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 305 7.2e-9 PFAM
Pfam:7tm_1 41 290 1.4e-36 PFAM
Pfam:7tm_4 139 283 5.6e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206815
Predicted Effect probably benign
Transcript: ENSMUST00000215161
AA Change: L205F

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 C A 11: 110,036,439 (GRCm39) V557F possibly damaging Het
Abi3 A T 11: 95,732,851 (GRCm39) L41* probably null Het
Actn1 C A 12: 80,221,229 (GRCm39) probably null Het
Adamts15 G T 9: 30,813,358 (GRCm39) R936S probably benign Het
Angel2 T C 1: 190,665,068 (GRCm39) S22P probably benign Het
Ank2 T G 3: 126,740,470 (GRCm39) probably benign Het
Astn1 A G 1: 158,337,563 (GRCm39) D423G probably damaging Het
Casp9 A G 4: 141,523,849 (GRCm39) D78G probably damaging Het
Cbr4 A G 8: 61,940,887 (GRCm39) D2G probably benign Het
Ccdc8 T A 7: 16,730,506 (GRCm39) L665H probably damaging Het
Cdh23 T A 10: 60,167,105 (GRCm39) N1847I probably damaging Het
Cnst T C 1: 179,437,440 (GRCm39) W335R probably benign Het
Ddr2 T A 1: 169,832,671 (GRCm39) I130F probably benign Het
Dnah2 C T 11: 69,391,665 (GRCm39) A677T probably benign Het
Dzip3 C A 16: 48,772,205 (GRCm39) W488L probably damaging Het
Ephb3 T G 16: 21,040,763 (GRCm39) I637S probably damaging Het
Etv3 A G 3: 87,436,671 (GRCm39) D142G probably benign Het
Fabp5 C T 3: 10,081,149 (GRCm39) T126I probably benign Het
Fam13b A C 18: 34,627,827 (GRCm39) Y125D probably damaging Het
Fsip2 C A 2: 82,822,471 (GRCm39) P6068Q probably damaging Het
Gm11232 A G 4: 71,674,905 (GRCm39) F199S possibly damaging Het
Gm5493 A G 17: 22,967,034 (GRCm39) K57E probably benign Het
Gm7334 A G 17: 51,006,265 (GRCm39) M184V probably benign Het
Gm9894 T C 13: 67,911,954 (GRCm39) noncoding transcript Het
Gpd2 T A 2: 57,254,525 (GRCm39) N674K probably benign Het
H2-M10.6 A G 17: 37,123,959 (GRCm39) Y141C probably damaging Het
Heatr5a C T 12: 51,931,110 (GRCm39) E1796K probably benign Het
Hexim2 A G 11: 103,029,118 (GRCm39) T57A probably benign Het
Hrg A T 16: 22,773,268 (GRCm39) N134Y probably damaging Het
Hsd17b12 T C 2: 93,864,322 (GRCm39) T262A probably damaging Het
Irak3 G T 10: 119,979,042 (GRCm39) P470T probably damaging Het
Itgbl1 A T 14: 124,083,977 (GRCm39) D285V probably damaging Het
Kcp A T 6: 29,502,863 (GRCm39) V164E probably benign Het
Klhdc7b T A 15: 89,272,589 (GRCm39) M1157K probably damaging Het
Lcor G A 19: 41,571,986 (GRCm39) G247D possibly damaging Het
Mdc1 G A 17: 36,159,525 (GRCm39) G635D probably benign Het
Mdc1 A G 17: 36,168,464 (GRCm39) K1690R probably benign Het
Mpp3 A T 11: 101,909,365 (GRCm39) probably benign Het
Ncor2 G T 5: 125,097,075 (GRCm39) H2285N probably benign Het
Neb T A 2: 52,147,839 (GRCm39) T2727S probably benign Het
Nkx6-2 T C 7: 139,161,483 (GRCm39) D234G possibly damaging Het
Nlrp9c T C 7: 26,084,150 (GRCm39) I476M probably benign Het
Nrsn1 T G 13: 25,437,355 (GRCm39) Q191P probably damaging Het
Or14j10 A T 17: 37,934,858 (GRCm39) S223T possibly damaging Het
Or51ag1 T A 7: 103,156,006 (GRCm39) H49L probably benign Het
Patl1 T G 19: 11,914,718 (GRCm39) L623R probably damaging Het
Pdc T C 1: 150,209,117 (GRCm39) I200T probably benign Het
Pdzk1 A G 3: 96,775,742 (GRCm39) D370G probably benign Het
Pglyrp3 A T 3: 91,938,841 (GRCm39) I339F probably damaging Het
Plxnb1 T C 9: 108,945,679 (GRCm39) V2070A probably damaging Het
Poln G A 5: 34,266,775 (GRCm39) R461C probably damaging Het
Prl2b1 C A 13: 27,567,491 (GRCm39) V218L probably damaging Het
Pygl T C 12: 70,263,428 (GRCm39) D55G probably damaging Het
Rif1 C G 2: 51,985,856 (GRCm39) L614V probably damaging Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rsrp1 T C 4: 134,651,692 (GRCm39) F152S probably damaging Het
Sim2 T C 16: 93,898,110 (GRCm39) S115P probably damaging Het
Slc17a1 T A 13: 24,059,593 (GRCm39) I108K possibly damaging Het
Slc30a8 A G 15: 52,189,054 (GRCm39) D223G probably damaging Het
Slc39a4 A T 15: 76,500,342 (GRCm39) N69K probably benign Het
Slc51a T G 16: 32,298,584 (GRCm39) T58P probably damaging Het
Slc7a14 T C 3: 31,278,261 (GRCm39) H448R probably benign Het
Smc3 G A 19: 53,613,594 (GRCm39) probably null Het
Sox6 A T 7: 115,085,863 (GRCm39) D659E probably damaging Het
Stard9 GCCC GCC 2: 120,524,196 (GRCm39) probably null Het
Tsr1 C T 11: 74,791,119 (GRCm39) probably null Het
Ttc12 T C 9: 49,354,422 (GRCm39) K565E probably damaging Het
Ube4b A T 4: 149,452,768 (GRCm39) V386E probably benign Het
Ush2a T A 1: 188,460,293 (GRCm39) probably null Het
Usp5 C A 6: 124,794,576 (GRCm39) probably benign Het
Vmn1r216 T C 13: 23,284,105 (GRCm39) F263L probably benign Het
Vmn2r88 T A 14: 51,655,606 (GRCm39) L606* probably null Het
Wee2 T A 6: 40,426,554 (GRCm39) probably null Het
Zfhx3 T C 8: 109,519,159 (GRCm39) Y94H probably damaging Het
Zfp385c G A 11: 100,523,594 (GRCm39) P120L probably benign Het
Zscan4-ps3 T C 7: 11,344,228 (GRCm39) F62S probably damaging Het
Other mutations in Or1e30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Or1e30 APN 11 73,678,406 (GRCm39) missense probably damaging 1.00
IGL01621:Or1e30 APN 11 73,678,103 (GRCm39) missense probably damaging 0.99
IGL01630:Or1e30 APN 11 73,678,687 (GRCm39) missense probably benign 0.14
IGL01866:Or1e30 APN 11 73,678,654 (GRCm39) missense probably benign 0.28
IGL02577:Or1e30 APN 11 73,677,872 (GRCm39) missense probably damaging 1.00
IGL02617:Or1e30 APN 11 73,678,560 (GRCm39) missense probably benign 0.01
IGL03017:Or1e30 APN 11 73,678,344 (GRCm39) missense probably benign 0.01
IGL03215:Or1e30 APN 11 73,678,211 (GRCm39) missense probably damaging 1.00
IGL03342:Or1e30 APN 11 73,678,309 (GRCm39) missense probably benign 0.03
IGL03098:Or1e30 UTSW 11 73,678,529 (GRCm39) missense probably benign 0.29
R0115:Or1e30 UTSW 11 73,678,141 (GRCm39) missense possibly damaging 0.45
R0217:Or1e30 UTSW 11 73,678,214 (GRCm39) missense possibly damaging 0.90
R1971:Or1e30 UTSW 11 73,678,616 (GRCm39) missense probably damaging 1.00
R2033:Or1e30 UTSW 11 73,678,264 (GRCm39) missense probably benign 0.15
R2058:Or1e30 UTSW 11 73,678,100 (GRCm39) missense probably benign 0.00
R3051:Or1e30 UTSW 11 73,678,060 (GRCm39) missense probably benign 0.01
R3622:Or1e30 UTSW 11 73,678,567 (GRCm39) missense probably benign 0.00
R3913:Or1e30 UTSW 11 73,678,522 (GRCm39) missense probably damaging 1.00
R4545:Or1e30 UTSW 11 73,677,992 (GRCm39) missense probably damaging 1.00
R4656:Or1e30 UTSW 11 73,678,337 (GRCm39) missense probably damaging 1.00
R5120:Or1e30 UTSW 11 73,677,790 (GRCm39) missense probably benign 0.01
R5635:Or1e30 UTSW 11 73,678,460 (GRCm39) missense probably benign 0.26
R6151:Or1e30 UTSW 11 73,678,521 (GRCm39) nonsense probably null
R6885:Or1e30 UTSW 11 73,677,926 (GRCm39) missense possibly damaging 0.94
R6984:Or1e30 UTSW 11 73,678,603 (GRCm39) missense possibly damaging 0.91
R7057:Or1e30 UTSW 11 73,677,974 (GRCm39) missense possibly damaging 0.88
R7120:Or1e30 UTSW 11 73,677,940 (GRCm39) missense probably damaging 0.98
R7704:Or1e30 UTSW 11 73,678,616 (GRCm39) missense probably damaging 1.00
R8323:Or1e30 UTSW 11 73,677,766 (GRCm39) start codon destroyed probably damaging 1.00
R9100:Or1e30 UTSW 11 73,678,687 (GRCm39) missense probably benign 0.14
R9258:Or1e30 UTSW 11 73,678,281 (GRCm39) missense probably benign 0.28
R9384:Or1e30 UTSW 11 73,677,796 (GRCm39) missense probably benign
R9421:Or1e30 UTSW 11 73,677,927 (GRCm39) missense probably benign 0.23
R9450:Or1e30 UTSW 11 73,678,101 (GRCm39) missense possibly damaging 0.56
R9698:Or1e30 UTSW 11 73,678,442 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTATGCCAGTATCATGAGCCC -3'
(R):5'- GCAGATGGACCTAAGTAGATGC -3'

Sequencing Primer
(F):5'- CCCAAGCTCTGTGTGAGTC -3'
(R):5'- CCTAAGTAGATGCCAATAATTGTCCC -3'
Posted On 2017-06-26