Incidental Mutation 'R6020:Tsr1'
ID 478877
Institutional Source Beutler Lab
Gene Symbol Tsr1
Ensembl Gene ENSMUSG00000038335
Gene Name TSR1 20S rRNA accumulation
Synonyms
Accession Numbers
Essential gene? Probably essential (E-score: 0.963) question?
Stock # R6020 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 74788906-74800166 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) C to T at 74791119 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000080489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045807] [ENSMUST00000057631] [ENSMUST00000081799] [ENSMUST00000128230] [ENSMUST00000155702] [ENSMUST00000153316]
AlphaFold Q5SWD9
Predicted Effect probably damaging
Transcript: ENSMUST00000045807
AA Change: L233F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039027
Gene: ENSMUSG00000038335
AA Change: L233F

DomainStartEndE-ValueType
low complexity region 16 25 N/A INTRINSIC
AARP2CN 228 309 1.14e-28 SMART
low complexity region 373 383 N/A INTRINSIC
low complexity region 407 421 N/A INTRINSIC
low complexity region 429 452 N/A INTRINSIC
coiled coil region 453 478 N/A INTRINSIC
DUF663 486 772 2.6e-179 SMART
Predicted Effect probably null
Transcript: ENSMUST00000057631
SMART Domains Protein: ENSMUSP00000050496
Gene: ENSMUSG00000038351

DomainStartEndE-ValueType
RUN 128 188 4.3e-18 SMART
low complexity region 453 476 N/A INTRINSIC
TBC 563 965 3.57e-34 SMART
Predicted Effect probably null
Transcript: ENSMUST00000081799
SMART Domains Protein: ENSMUSP00000080489
Gene: ENSMUSG00000038351

DomainStartEndE-ValueType
RUN 128 188 4.3e-18 SMART
low complexity region 446 453 N/A INTRINSIC
low complexity region 498 521 N/A INTRINSIC
TBC 608 1010 3.57e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128230
SMART Domains Protein: ENSMUSP00000121384
Gene: ENSMUSG00000038335

DomainStartEndE-ValueType
low complexity region 16 25 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155785
Predicted Effect probably benign
Transcript: ENSMUST00000155702
SMART Domains Protein: ENSMUSP00000119868
Gene: ENSMUSG00000038335

DomainStartEndE-ValueType
low complexity region 16 25 N/A INTRINSIC
low complexity region 39 58 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153316
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 C A 11: 110,036,439 (GRCm39) V557F possibly damaging Het
Abi3 A T 11: 95,732,851 (GRCm39) L41* probably null Het
Actn1 C A 12: 80,221,229 (GRCm39) probably null Het
Adamts15 G T 9: 30,813,358 (GRCm39) R936S probably benign Het
Angel2 T C 1: 190,665,068 (GRCm39) S22P probably benign Het
Ank2 T G 3: 126,740,470 (GRCm39) probably benign Het
Astn1 A G 1: 158,337,563 (GRCm39) D423G probably damaging Het
Casp9 A G 4: 141,523,849 (GRCm39) D78G probably damaging Het
Cbr4 A G 8: 61,940,887 (GRCm39) D2G probably benign Het
Ccdc8 T A 7: 16,730,506 (GRCm39) L665H probably damaging Het
Cdh23 T A 10: 60,167,105 (GRCm39) N1847I probably damaging Het
Cnst T C 1: 179,437,440 (GRCm39) W335R probably benign Het
Ddr2 T A 1: 169,832,671 (GRCm39) I130F probably benign Het
Dnah2 C T 11: 69,391,665 (GRCm39) A677T probably benign Het
Dzip3 C A 16: 48,772,205 (GRCm39) W488L probably damaging Het
Ephb3 T G 16: 21,040,763 (GRCm39) I637S probably damaging Het
Etv3 A G 3: 87,436,671 (GRCm39) D142G probably benign Het
Fabp5 C T 3: 10,081,149 (GRCm39) T126I probably benign Het
Fam13b A C 18: 34,627,827 (GRCm39) Y125D probably damaging Het
Fsip2 C A 2: 82,822,471 (GRCm39) P6068Q probably damaging Het
Gm11232 A G 4: 71,674,905 (GRCm39) F199S possibly damaging Het
Gm5493 A G 17: 22,967,034 (GRCm39) K57E probably benign Het
Gm7334 A G 17: 51,006,265 (GRCm39) M184V probably benign Het
Gm9894 T C 13: 67,911,954 (GRCm39) noncoding transcript Het
Gpd2 T A 2: 57,254,525 (GRCm39) N674K probably benign Het
H2-M10.6 A G 17: 37,123,959 (GRCm39) Y141C probably damaging Het
Heatr5a C T 12: 51,931,110 (GRCm39) E1796K probably benign Het
Hexim2 A G 11: 103,029,118 (GRCm39) T57A probably benign Het
Hrg A T 16: 22,773,268 (GRCm39) N134Y probably damaging Het
Hsd17b12 T C 2: 93,864,322 (GRCm39) T262A probably damaging Het
Irak3 G T 10: 119,979,042 (GRCm39) P470T probably damaging Het
Itgbl1 A T 14: 124,083,977 (GRCm39) D285V probably damaging Het
Kcp A T 6: 29,502,863 (GRCm39) V164E probably benign Het
Klhdc7b T A 15: 89,272,589 (GRCm39) M1157K probably damaging Het
Lcor G A 19: 41,571,986 (GRCm39) G247D possibly damaging Het
Mdc1 G A 17: 36,159,525 (GRCm39) G635D probably benign Het
Mdc1 A G 17: 36,168,464 (GRCm39) K1690R probably benign Het
Mpp3 A T 11: 101,909,365 (GRCm39) probably benign Het
Ncor2 G T 5: 125,097,075 (GRCm39) H2285N probably benign Het
Neb T A 2: 52,147,839 (GRCm39) T2727S probably benign Het
Nkx6-2 T C 7: 139,161,483 (GRCm39) D234G possibly damaging Het
Nlrp9c T C 7: 26,084,150 (GRCm39) I476M probably benign Het
Nrsn1 T G 13: 25,437,355 (GRCm39) Q191P probably damaging Het
Or14j10 A T 17: 37,934,858 (GRCm39) S223T possibly damaging Het
Or1e30 C T 11: 73,678,378 (GRCm39) L205F probably benign Het
Or51ag1 T A 7: 103,156,006 (GRCm39) H49L probably benign Het
Patl1 T G 19: 11,914,718 (GRCm39) L623R probably damaging Het
Pdc T C 1: 150,209,117 (GRCm39) I200T probably benign Het
Pdzk1 A G 3: 96,775,742 (GRCm39) D370G probably benign Het
Pglyrp3 A T 3: 91,938,841 (GRCm39) I339F probably damaging Het
Plxnb1 T C 9: 108,945,679 (GRCm39) V2070A probably damaging Het
Poln G A 5: 34,266,775 (GRCm39) R461C probably damaging Het
Prl2b1 C A 13: 27,567,491 (GRCm39) V218L probably damaging Het
Pygl T C 12: 70,263,428 (GRCm39) D55G probably damaging Het
Rif1 C G 2: 51,985,856 (GRCm39) L614V probably damaging Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rsrp1 T C 4: 134,651,692 (GRCm39) F152S probably damaging Het
Sim2 T C 16: 93,898,110 (GRCm39) S115P probably damaging Het
Slc17a1 T A 13: 24,059,593 (GRCm39) I108K possibly damaging Het
Slc30a8 A G 15: 52,189,054 (GRCm39) D223G probably damaging Het
Slc39a4 A T 15: 76,500,342 (GRCm39) N69K probably benign Het
Slc51a T G 16: 32,298,584 (GRCm39) T58P probably damaging Het
Slc7a14 T C 3: 31,278,261 (GRCm39) H448R probably benign Het
Smc3 G A 19: 53,613,594 (GRCm39) probably null Het
Sox6 A T 7: 115,085,863 (GRCm39) D659E probably damaging Het
Stard9 GCCC GCC 2: 120,524,196 (GRCm39) probably null Het
Ttc12 T C 9: 49,354,422 (GRCm39) K565E probably damaging Het
Ube4b A T 4: 149,452,768 (GRCm39) V386E probably benign Het
Ush2a T A 1: 188,460,293 (GRCm39) probably null Het
Usp5 C A 6: 124,794,576 (GRCm39) probably benign Het
Vmn1r216 T C 13: 23,284,105 (GRCm39) F263L probably benign Het
Vmn2r88 T A 14: 51,655,606 (GRCm39) L606* probably null Het
Wee2 T A 6: 40,426,554 (GRCm39) probably null Het
Zfhx3 T C 8: 109,519,159 (GRCm39) Y94H probably damaging Het
Zfp385c G A 11: 100,523,594 (GRCm39) P120L probably benign Het
Zscan4-ps3 T C 7: 11,344,228 (GRCm39) F62S probably damaging Het
Other mutations in Tsr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02568:Tsr1 APN 11 74,791,204 (GRCm39) missense probably benign 0.19
IGL02959:Tsr1 APN 11 74,791,075 (GRCm39) missense probably benign 0.00
IGL03230:Tsr1 APN 11 74,791,297 (GRCm39) missense probably benign 0.00
IGL03358:Tsr1 APN 11 74,794,824 (GRCm39) missense probably benign 0.13
R0684:Tsr1 UTSW 11 74,798,767 (GRCm39) missense probably damaging 1.00
R1452:Tsr1 UTSW 11 74,790,425 (GRCm39) missense probably benign 0.21
R1484:Tsr1 UTSW 11 74,792,914 (GRCm39) missense probably damaging 1.00
R1831:Tsr1 UTSW 11 74,791,182 (GRCm39) missense probably benign 0.00
R2166:Tsr1 UTSW 11 74,798,280 (GRCm39) splice site probably null
R2185:Tsr1 UTSW 11 74,792,906 (GRCm39) missense probably damaging 1.00
R2273:Tsr1 UTSW 11 74,795,653 (GRCm39) critical splice acceptor site probably null
R2274:Tsr1 UTSW 11 74,795,653 (GRCm39) critical splice acceptor site probably null
R2275:Tsr1 UTSW 11 74,795,653 (GRCm39) critical splice acceptor site probably null
R2289:Tsr1 UTSW 11 74,790,111 (GRCm39) missense probably damaging 0.98
R3606:Tsr1 UTSW 11 74,796,059 (GRCm39) missense probably benign 0.01
R4928:Tsr1 UTSW 11 74,798,705 (GRCm39) missense probably benign
R5260:Tsr1 UTSW 11 74,796,781 (GRCm39) missense probably damaging 1.00
R6743:Tsr1 UTSW 11 74,799,177 (GRCm39) missense probably benign 0.00
R7068:Tsr1 UTSW 11 74,794,745 (GRCm39) nonsense probably null
R7117:Tsr1 UTSW 11 74,790,360 (GRCm39) missense probably benign
R7868:Tsr1 UTSW 11 74,791,158 (GRCm39) missense possibly damaging 0.66
R8392:Tsr1 UTSW 11 74,791,096 (GRCm39) missense probably benign 0.40
R8734:Tsr1 UTSW 11 74,794,652 (GRCm39) missense probably benign
R8767:Tsr1 UTSW 11 74,799,149 (GRCm39) missense probably damaging 0.96
R8904:Tsr1 UTSW 11 74,790,217 (GRCm39) nonsense probably null
R9261:Tsr1 UTSW 11 74,799,056 (GRCm39) missense probably damaging 1.00
R9295:Tsr1 UTSW 11 74,799,135 (GRCm39) missense probably damaging 1.00
R9345:Tsr1 UTSW 11 74,790,126 (GRCm39) missense probably benign 0.03
R9802:Tsr1 UTSW 11 74,799,225 (GRCm39) missense possibly damaging 0.54
X0010:Tsr1 UTSW 11 74,794,700 (GRCm39) missense possibly damaging 0.78
X0026:Tsr1 UTSW 11 74,791,053 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACAATGACTTCCTGCGCTC -3'
(R):5'- GGATCCACAGGAGCATCTATTTG -3'

Sequencing Primer
(F):5'- AATGACTTCCTGCGCTCTTCTC -3'
(R):5'- TTTGGAAATCACCGTGTCCAAC -3'
Posted On 2017-06-26