Incidental Mutation 'R6020:Pygl'
ID 478885
Institutional Source Beutler Lab
Gene Symbol Pygl
Ensembl Gene ENSMUSG00000021069
Gene Name liver glycogen phosphorylase
Synonyms
Accession Numbers
Essential gene? Possibly essential (E-score: 0.586) question?
Stock # R6020 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 70237589-70274457 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70263428 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 55 (D55G)
Ref Sequence ENSEMBL: ENSMUSP00000125585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071250] [ENSMUST00000161083]
AlphaFold Q9ET01
Predicted Effect probably damaging
Transcript: ENSMUST00000071250
AA Change: D146G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071231
Gene: ENSMUSG00000021069
AA Change: D146G

DomainStartEndE-ValueType
Pfam:Phosphorylase 113 829 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161083
AA Change: D55G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125585
Gene: ENSMUSG00000021069
AA Change: D55G

DomainStartEndE-ValueType
Pfam:Phosphorylase 21 739 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161840
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166609
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homodimeric protein that catalyses the cleavage of alpha-1,4-glucosidic bonds to release glucose-1-phosphate from liver glycogen stores. This protein switches from inactive phosphorylase B to active phosphorylase A by phosphorylation of serine residue 15. Activity of this enzyme is further regulated by multiple allosteric effectors and hormonal controls. Humans have three glycogen phosphorylase genes that encode distinct isozymes that are primarily expressed in liver, brain and muscle, respectively. The liver isozyme serves the glycemic demands of the body in general while the brain and muscle isozymes supply just those tissues. In glycogen storage disease type VI, also known as Hers disease, mutations in liver glycogen phosphorylase inhibit the conversion of glycogen to glucose and results in moderate hypoglycemia, mild ketosis, growth retardation and hepatomegaly. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 C A 11: 110,036,439 (GRCm39) V557F possibly damaging Het
Abi3 A T 11: 95,732,851 (GRCm39) L41* probably null Het
Actn1 C A 12: 80,221,229 (GRCm39) probably null Het
Adamts15 G T 9: 30,813,358 (GRCm39) R936S probably benign Het
Angel2 T C 1: 190,665,068 (GRCm39) S22P probably benign Het
Ank2 T G 3: 126,740,470 (GRCm39) probably benign Het
Astn1 A G 1: 158,337,563 (GRCm39) D423G probably damaging Het
Casp9 A G 4: 141,523,849 (GRCm39) D78G probably damaging Het
Cbr4 A G 8: 61,940,887 (GRCm39) D2G probably benign Het
Ccdc8 T A 7: 16,730,506 (GRCm39) L665H probably damaging Het
Cdh23 T A 10: 60,167,105 (GRCm39) N1847I probably damaging Het
Cnst T C 1: 179,437,440 (GRCm39) W335R probably benign Het
Ddr2 T A 1: 169,832,671 (GRCm39) I130F probably benign Het
Dnah2 C T 11: 69,391,665 (GRCm39) A677T probably benign Het
Dzip3 C A 16: 48,772,205 (GRCm39) W488L probably damaging Het
Ephb3 T G 16: 21,040,763 (GRCm39) I637S probably damaging Het
Etv3 A G 3: 87,436,671 (GRCm39) D142G probably benign Het
Fabp5 C T 3: 10,081,149 (GRCm39) T126I probably benign Het
Fam13b A C 18: 34,627,827 (GRCm39) Y125D probably damaging Het
Fsip2 C A 2: 82,822,471 (GRCm39) P6068Q probably damaging Het
Gm11232 A G 4: 71,674,905 (GRCm39) F199S possibly damaging Het
Gm5493 A G 17: 22,967,034 (GRCm39) K57E probably benign Het
Gm7334 A G 17: 51,006,265 (GRCm39) M184V probably benign Het
Gm9894 T C 13: 67,911,954 (GRCm39) noncoding transcript Het
Gpd2 T A 2: 57,254,525 (GRCm39) N674K probably benign Het
H2-M10.6 A G 17: 37,123,959 (GRCm39) Y141C probably damaging Het
Heatr5a C T 12: 51,931,110 (GRCm39) E1796K probably benign Het
Hexim2 A G 11: 103,029,118 (GRCm39) T57A probably benign Het
Hrg A T 16: 22,773,268 (GRCm39) N134Y probably damaging Het
Hsd17b12 T C 2: 93,864,322 (GRCm39) T262A probably damaging Het
Irak3 G T 10: 119,979,042 (GRCm39) P470T probably damaging Het
Itgbl1 A T 14: 124,083,977 (GRCm39) D285V probably damaging Het
Kcp A T 6: 29,502,863 (GRCm39) V164E probably benign Het
Klhdc7b T A 15: 89,272,589 (GRCm39) M1157K probably damaging Het
Lcor G A 19: 41,571,986 (GRCm39) G247D possibly damaging Het
Mdc1 G A 17: 36,159,525 (GRCm39) G635D probably benign Het
Mdc1 A G 17: 36,168,464 (GRCm39) K1690R probably benign Het
Mpp3 A T 11: 101,909,365 (GRCm39) probably benign Het
Ncor2 G T 5: 125,097,075 (GRCm39) H2285N probably benign Het
Neb T A 2: 52,147,839 (GRCm39) T2727S probably benign Het
Nkx6-2 T C 7: 139,161,483 (GRCm39) D234G possibly damaging Het
Nlrp9c T C 7: 26,084,150 (GRCm39) I476M probably benign Het
Nrsn1 T G 13: 25,437,355 (GRCm39) Q191P probably damaging Het
Or14j10 A T 17: 37,934,858 (GRCm39) S223T possibly damaging Het
Or1e30 C T 11: 73,678,378 (GRCm39) L205F probably benign Het
Or51ag1 T A 7: 103,156,006 (GRCm39) H49L probably benign Het
Patl1 T G 19: 11,914,718 (GRCm39) L623R probably damaging Het
Pdc T C 1: 150,209,117 (GRCm39) I200T probably benign Het
Pdzk1 A G 3: 96,775,742 (GRCm39) D370G probably benign Het
Pglyrp3 A T 3: 91,938,841 (GRCm39) I339F probably damaging Het
Plxnb1 T C 9: 108,945,679 (GRCm39) V2070A probably damaging Het
Poln G A 5: 34,266,775 (GRCm39) R461C probably damaging Het
Prl2b1 C A 13: 27,567,491 (GRCm39) V218L probably damaging Het
Rif1 C G 2: 51,985,856 (GRCm39) L614V probably damaging Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rsrp1 T C 4: 134,651,692 (GRCm39) F152S probably damaging Het
Sim2 T C 16: 93,898,110 (GRCm39) S115P probably damaging Het
Slc17a1 T A 13: 24,059,593 (GRCm39) I108K possibly damaging Het
Slc30a8 A G 15: 52,189,054 (GRCm39) D223G probably damaging Het
Slc39a4 A T 15: 76,500,342 (GRCm39) N69K probably benign Het
Slc51a T G 16: 32,298,584 (GRCm39) T58P probably damaging Het
Slc7a14 T C 3: 31,278,261 (GRCm39) H448R probably benign Het
Smc3 G A 19: 53,613,594 (GRCm39) probably null Het
Sox6 A T 7: 115,085,863 (GRCm39) D659E probably damaging Het
Stard9 GCCC GCC 2: 120,524,196 (GRCm39) probably null Het
Tsr1 C T 11: 74,791,119 (GRCm39) probably null Het
Ttc12 T C 9: 49,354,422 (GRCm39) K565E probably damaging Het
Ube4b A T 4: 149,452,768 (GRCm39) V386E probably benign Het
Ush2a T A 1: 188,460,293 (GRCm39) probably null Het
Usp5 C A 6: 124,794,576 (GRCm39) probably benign Het
Vmn1r216 T C 13: 23,284,105 (GRCm39) F263L probably benign Het
Vmn2r88 T A 14: 51,655,606 (GRCm39) L606* probably null Het
Wee2 T A 6: 40,426,554 (GRCm39) probably null Het
Zfhx3 T C 8: 109,519,159 (GRCm39) Y94H probably damaging Het
Zfp385c G A 11: 100,523,594 (GRCm39) P120L probably benign Het
Zscan4-ps3 T C 7: 11,344,228 (GRCm39) F62S probably damaging Het
Other mutations in Pygl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Pygl APN 12 70,237,866 (GRCm39) missense probably damaging 1.00
IGL00903:Pygl APN 12 70,254,516 (GRCm39) missense probably damaging 1.00
IGL01965:Pygl APN 12 70,237,888 (GRCm39) missense probably benign 0.00
IGL02347:Pygl APN 12 70,248,666 (GRCm39) missense probably benign 0.14
IGL02403:Pygl APN 12 70,241,032 (GRCm39) missense probably benign
IGL02501:Pygl APN 12 70,237,908 (GRCm39) missense probably benign 0.05
IGL02727:Pygl APN 12 70,254,442 (GRCm39) splice site probably null
IGL03125:Pygl APN 12 70,244,256 (GRCm39) missense probably damaging 1.00
IGL03158:Pygl APN 12 70,242,449 (GRCm39) missense probably damaging 1.00
IGL03202:Pygl APN 12 70,246,420 (GRCm39) missense probably benign
IGL03368:Pygl APN 12 70,237,926 (GRCm39) missense probably benign
R0096:Pygl UTSW 12 70,237,940 (GRCm39) splice site probably benign
R0096:Pygl UTSW 12 70,237,940 (GRCm39) splice site probably benign
R0524:Pygl UTSW 12 70,254,498 (GRCm39) missense probably damaging 1.00
R0883:Pygl UTSW 12 70,253,178 (GRCm39) missense probably damaging 0.97
R0894:Pygl UTSW 12 70,241,148 (GRCm39) splice site probably benign
R0905:Pygl UTSW 12 70,257,791 (GRCm39) splice site probably benign
R1494:Pygl UTSW 12 70,246,504 (GRCm39) missense probably damaging 0.98
R1621:Pygl UTSW 12 70,237,866 (GRCm39) missense probably damaging 1.00
R1647:Pygl UTSW 12 70,243,784 (GRCm39) missense possibly damaging 0.60
R3082:Pygl UTSW 12 70,244,303 (GRCm39) missense probably damaging 1.00
R3845:Pygl UTSW 12 70,245,217 (GRCm39) missense probably benign 0.12
R3876:Pygl UTSW 12 70,248,113 (GRCm39) missense probably damaging 1.00
R4358:Pygl UTSW 12 70,242,464 (GRCm39) missense probably damaging 1.00
R4614:Pygl UTSW 12 70,257,753 (GRCm39) splice site probably null
R4707:Pygl UTSW 12 70,254,532 (GRCm39) missense possibly damaging 0.69
R4908:Pygl UTSW 12 70,243,807 (GRCm39) missense probably null
R4940:Pygl UTSW 12 70,253,155 (GRCm39) missense probably damaging 1.00
R5077:Pygl UTSW 12 70,248,666 (GRCm39) missense probably benign 0.14
R5186:Pygl UTSW 12 70,248,118 (GRCm39) missense probably damaging 1.00
R5726:Pygl UTSW 12 70,237,916 (GRCm39) nonsense probably null
R5953:Pygl UTSW 12 70,266,401 (GRCm39) missense probably damaging 1.00
R5957:Pygl UTSW 12 70,246,494 (GRCm39) missense probably damaging 0.99
R6024:Pygl UTSW 12 70,243,841 (GRCm39) missense probably benign 0.09
R7050:Pygl UTSW 12 70,266,396 (GRCm39) missense probably damaging 1.00
R7159:Pygl UTSW 12 70,244,180 (GRCm39) missense probably benign 0.41
R7194:Pygl UTSW 12 70,241,094 (GRCm39) missense probably benign
R7283:Pygl UTSW 12 70,263,342 (GRCm39) missense possibly damaging 0.92
R7360:Pygl UTSW 12 70,274,306 (GRCm39) missense probably benign 0.11
R7446:Pygl UTSW 12 70,243,784 (GRCm39) missense probably benign
R7637:Pygl UTSW 12 70,244,569 (GRCm39) splice site probably null
R7886:Pygl UTSW 12 70,253,130 (GRCm39) splice site probably null
R8054:Pygl UTSW 12 70,274,113 (GRCm39) critical splice donor site probably null
R8693:Pygl UTSW 12 70,244,180 (GRCm39) missense probably benign 0.41
R8753:Pygl UTSW 12 70,242,400 (GRCm39) missense probably damaging 1.00
R8803:Pygl UTSW 12 70,242,390 (GRCm39) missense probably damaging 1.00
R8842:Pygl UTSW 12 70,274,368 (GRCm39) intron probably benign
R9192:Pygl UTSW 12 70,243,822 (GRCm39) missense probably damaging 0.99
R9221:Pygl UTSW 12 70,242,401 (GRCm39) missense probably damaging 1.00
R9437:Pygl UTSW 12 70,246,925 (GRCm39) missense probably damaging 1.00
R9750:Pygl UTSW 12 70,245,303 (GRCm39) missense possibly damaging 0.68
Z1176:Pygl UTSW 12 70,269,648 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GTGCTGTATGAAAGGCCCAC -3'
(R):5'- AGCATGTACACAGTCACTATTCAAG -3'

Sequencing Primer
(F):5'- TGTATGAAAGGCCCACGCTATTC -3'
(R):5'- GGGATTTGAACTCAGGACCTCTAC -3'
Posted On 2017-06-26