Mutagenetix > Incidental Mutation

Incidental Mutation 'R6020:Ephb3'

478896

Institutional Source

Beutler Lab

Gene Symbol

Ephb3

Ensembl Gene

ENSMUSG00000005958

Gene Name

Eph receptor B3

Synonyms

Tyro6, HEK2, MDK5, Sek4, Etk2, Cek10

Accession Numbers

Essential gene?

Probably essential (E-score: 0.927) question?

Stock #

R6020 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

21204755-21223305 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 21222013 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Serine at position 637 (I637S)

Ref Sequence

ENSEMBL: ENSMUSP00000124375 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006112] [ENSMUST00000161063]

AlphaFold

P54754

Predicted Effect

probably damaging
Transcript: ENSMUST00000006112
AA Change: I891S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000006112
Gene: ENSMUSG00000005958
AA Change: I891S

Domain	Start	End	E-Value	Type
low complexity region	6	26	N/A	INTRINSIC
EPH_lbd	31	204	6.47e-126	SMART
Pfam:GCC2_GCC3	269	312	5.8e-9	PFAM
FN3	332	430	8.43e-9	SMART
FN3	448	527	2.72e-12	SMART
Pfam:EphA2_TM	555	625	1e-24	PFAM
TyrKc	628	887	1.35e-134	SMART
SAM	917	984	3.88e-24	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159575

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160053

Predicted Effect

probably damaging
Transcript: ENSMUST00000161063
AA Change: I637S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into two groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. This gene encodes a receptor for ephrin-B family members. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects in corpus callosum formation and impaired Paneth cell downward migration in the intestinal epithelium, resulting in scattered positioning along crypt and villus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	C	A	11: 110,145,613	V557F	possibly damaging	Het
Abi3	A	T	11: 95,842,025	L41*	probably null	Het
Actn1	C	A	12: 80,174,455		probably null	Het
Adamts15	G	T	9: 30,902,062	R936S	probably benign	Het
Angel2	T	C	1: 190,932,871	S22P	probably benign	Het
Ank2	T	G	3: 126,946,821		probably benign	Het
Astn1	A	G	1: 158,509,993	D423G	probably damaging	Het
Casp9	A	G	4: 141,796,538	D78G	probably damaging	Het
Cbr4	A	G	8: 61,487,853	D2G	probably benign	Het
Ccdc8	T	A	7: 16,996,581	L665H	probably damaging	Het
Cdh23	T	A	10: 60,331,326	N1847I	probably damaging	Het
Cnst	T	C	1: 179,609,875	W335R	probably benign	Het
Ddr2	T	A	1: 170,005,102	I130F	probably benign	Het
Dnah2	C	T	11: 69,500,839	A677T	probably benign	Het
Dzip3	C	A	16: 48,951,842	W488L	probably damaging	Het
Etv3	A	G	3: 87,529,364	D142G	probably benign	Het
Fabp5	C	T	3: 10,016,089	T126I	probably benign	Het
Fam13b	A	C	18: 34,494,774	Y125D	probably damaging	Het
Fsip2	C	A	2: 82,992,127	P6068Q	probably damaging	Het
Gm11232	A	G	4: 71,756,668	F199S	possibly damaging	Het
Gm340	G	A	19: 41,583,547	G247D	possibly damaging	Het
Gm5493	A	G	17: 22,748,061	K57E	probably benign	Het
Gm7334	A	G	17: 50,699,237	M184V	probably benign	Het
Gm9894	T	C	13: 67,763,835		noncoding transcript	Het
Gpd2	T	A	2: 57,364,513	N674K	probably benign	Het
H2-M10.6	A	G	17: 36,813,067	Y141C	probably damaging	Het
Heatr5a	C	T	12: 51,884,327	E1796K	probably benign	Het
Hexim2	A	G	11: 103,138,292	T57A	probably benign	Het
Hrg	A	T	16: 22,954,518	N134Y	probably damaging	Het
Hsd17b12	T	C	2: 94,033,977	T262A	probably damaging	Het
Irak3	G	T	10: 120,143,137	P470T	probably damaging	Het
Itgbl1	A	T	14: 123,846,565	D285V	probably damaging	Het
Kcp	A	T	6: 29,502,864	V164E	probably benign	Het
Klhdc7b	T	A	15: 89,388,386	M1157K	probably damaging	Het
Mdc1	G	A	17: 35,848,633	G635D	probably benign	Het
Mdc1	A	G	17: 35,857,572	K1690R	probably benign	Het
Mpp3	A	T	11: 102,018,539		probably benign	Het
Ncor2	G	T	5: 125,020,011	H2285N	probably benign	Het
Neb	T	A	2: 52,257,827	T2727S	probably benign	Het
Nkx6-2	T	C	7: 139,581,567	D234G	possibly damaging	Het
Nlrp9c	T	C	7: 26,384,725	I476M	probably benign	Het
Nrsn1	T	G	13: 25,253,372	Q191P	probably damaging	Het
Olfr116	A	T	17: 37,623,967	S223T	possibly damaging	Het
Olfr390	C	T	11: 73,787,552	L205F	probably benign	Het
Olfr610	T	A	7: 103,506,799	H49L	probably benign	Het
Patl1	T	G	19: 11,937,354	L623R	probably damaging	Het
Pdc	T	C	1: 150,333,366	I200T	probably benign	Het
Pdzk1	A	G	3: 96,868,426	D370G	probably benign	Het
Pglyrp3	A	T	3: 92,031,534	I339F	probably damaging	Het
Plxnb1	T	C	9: 109,116,611	V2070A	probably damaging	Het
Poln	G	A	5: 34,109,431	R461C	probably damaging	Het
Prl2b1	C	A	13: 27,383,508	V218L	probably damaging	Het
Pygl	T	C	12: 70,216,654	D55G	probably damaging	Het
Rif1	C	G	2: 52,095,844	L614V	probably damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
RP24-351P7.8	T	C	7: 11,610,301	F62S	probably damaging	Het
Rsrp1	T	C	4: 134,924,381	F152S	probably damaging	Het
Sim2	T	C	16: 94,097,251	S115P	probably damaging	Het
Slc17a1	T	A	13: 23,875,610	I108K	possibly damaging	Het
Slc30a8	A	G	15: 52,325,658	D223G	probably damaging	Het
Slc39a4	A	T	15: 76,616,142	N69K	probably benign	Het
Slc51a	T	G	16: 32,479,766	T58P	probably damaging	Het
Slc7a14	T	C	3: 31,224,112	H448R	probably benign	Het
Smc3	G	A	19: 53,625,163		probably null	Het
Sox6	A	T	7: 115,486,628	D659E	probably damaging	Het
Stard9	GCCC	GCC	2: 120,693,715		probably null	Het
Tsr1	C	T	11: 74,900,293		probably null	Het
Ttc12	T	C	9: 49,443,122	K565E	probably damaging	Het
Ube4b	A	T	4: 149,368,311	V386E	probably benign	Het
Ush2a	T	A	1: 188,728,096		probably null	Het
Usp5	C	A	6: 124,817,613		probably benign	Het
Vmn1r216	T	C	13: 23,099,935	F263L	probably benign	Het
Vmn2r88	T	A	14: 51,418,149	L606*	probably null	Het
Wee2	T	A	6: 40,449,620		probably null	Het
Zfhx3	T	C	8: 108,792,527	Y94H	probably damaging	Het
Zfp385c	G	A	11: 100,632,768	P120L	probably benign	Het

Other mutations in Ephb3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00476:Ephb3	APN	16	21220415	splice site	probably null
IGL00966:Ephb3	APN	16	21217294	missense	probably benign	0.00
IGL02166:Ephb3	APN	16	21220749	missense	probably damaging	1.00
IGL02245:Ephb3	APN	16	21221424	missense	probably benign	0.04
IGL02321:Ephb3	APN	16	21214389	missense	probably damaging	1.00
IGL02337:Ephb3	APN	16	21221503	splice site	probably null
IGL02507:Ephb3	APN	16	21220639	splice site	probably benign
IGL02755:Ephb3	APN	16	21221698	missense	probably damaging	1.00
IGL02806:Ephb3	APN	16	21222281	missense	probably benign	0.02
PIT4362001:Ephb3	UTSW	16	21220857	missense	probably damaging	1.00
R0026:Ephb3	UTSW	16	21214917	missense	probably damaging	1.00
R0194:Ephb3	UTSW	16	21218109	missense	probably benign	0.01
R0196:Ephb3	UTSW	16	21218054	missense	probably damaging	1.00
R0230:Ephb3	UTSW	16	21220775	missense	probably damaging	1.00
R0828:Ephb3	UTSW	16	21219034	unclassified	probably benign
R1126:Ephb3	UTSW	16	21222476	missense	possibly damaging	0.87
R1460:Ephb3	UTSW	16	21218922	missense	probably benign
R1592:Ephb3	UTSW	16	21221700	missense	probably damaging	1.00
R1632:Ephb3	UTSW	16	21212937	missense	probably benign	0.00
R1694:Ephb3	UTSW	16	21221745	missense	probably damaging	1.00
R1719:Ephb3	UTSW	16	21220650	missense	probably damaging	1.00
R1777:Ephb3	UTSW	16	21217235	missense	probably damaging	0.99
R1928:Ephb3	UTSW	16	21222295	missense	possibly damaging	0.86
R1956:Ephb3	UTSW	16	21221382	missense	probably damaging	1.00
R2378:Ephb3	UTSW	16	21218243	missense	probably benign
R3408:Ephb3	UTSW	16	21219504	missense	probably damaging	0.99
R4027:Ephb3	UTSW	16	21221697	missense	probably damaging	1.00
R4429:Ephb3	UTSW	16	21214463	missense	probably damaging	1.00
R4655:Ephb3	UTSW	16	21222208	missense	probably damaging	0.98
R4826:Ephb3	UTSW	16	21214995	missense	possibly damaging	0.90
R4828:Ephb3	UTSW	16	21214995	missense	possibly damaging	0.90
R4960:Ephb3	UTSW	16	21220495	missense	probably benign	0.09
R5057:Ephb3	UTSW	16	21220447	missense	probably damaging	1.00
R5090:Ephb3	UTSW	16	21214487	missense	probably damaging	1.00
R5396:Ephb3	UTSW	16	21219105	missense	possibly damaging	0.91
R5540:Ephb3	UTSW	16	21220860	missense	probably damaging	1.00
R5628:Ephb3	UTSW	16	21218119	missense	probably damaging	1.00
R5666:Ephb3	UTSW	16	21222491	missense	probably benign	0.08
R5838:Ephb3	UTSW	16	21221687	missense	probably damaging	1.00
R5866:Ephb3	UTSW	16	21211379	intron	probably benign
R6017:Ephb3	UTSW	16	21222031	missense	probably damaging	1.00
R6510:Ephb3	UTSW	16	21218111	missense	probably damaging	0.98
R6539:Ephb3	UTSW	16	21221468	missense	probably benign
R6591:Ephb3	UTSW	16	21214473	missense	probably damaging	1.00
R6691:Ephb3	UTSW	16	21214473	missense	probably damaging	1.00
R7101:Ephb3	UTSW	16	21218518	missense	possibly damaging	0.86
R7111:Ephb3	UTSW	16	21218827	nonsense	probably null
R7236:Ephb3	UTSW	16	21214481	missense	probably damaging	1.00
R7307:Ephb3	UTSW	16	21222226	missense	probably benign	0.04
R7410:Ephb3	UTSW	16	21221408	missense	possibly damaging	0.75
R7413:Ephb3	UTSW	16	21214707	missense	probably damaging	1.00
R7452:Ephb3	UTSW	16	21217357	splice site	probably null
R7944:Ephb3	UTSW	16	21221684	missense	probably damaging	1.00
R7945:Ephb3	UTSW	16	21221684	missense	probably damaging	1.00
R9092:Ephb3	UTSW	16	21222464	missense	probably benign	0.01
R9504:Ephb3	UTSW	16	21218080	missense	possibly damaging	0.48
R9706:Ephb3	UTSW	16	21220443	missense	probably damaging	1.00
Z1176:Ephb3	UTSW	16	21218036	missense	possibly damaging	0.53

Predicted Primers

PCR Primer
(F):5'- GGAACTCATTTCAGATTCCCTACC -3'
(R):5'- CCCATCTTGATGGCATCTAGC -3'

Sequencing Primer
(F):5'- CCATTATCCAGGTCATTAATGCTG -3'
(R):5'- TGGGAGCCAGGATACTAA -3'

Posted On

2017-06-26