Incidental Mutation 'R6020:Hrg'
ID 478897
Institutional Source Beutler Lab
Gene Symbol Hrg
Ensembl Gene ENSMUSG00000022877
Gene Name histidine-rich glycoprotein
Synonyms D18020, D16JH2
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.339) question?
Stock # R6020 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 22769822-22780406 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 22773268 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 134 (N134Y)
Ref Sequence ENSEMBL: ENSMUSP00000155962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023590] [ENSMUST00000232422]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000023590
AA Change: N134Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023590
Gene: ENSMUSG00000022877
AA Change: N134Y

DomainStartEndE-ValueType
CY 22 133 8.98e-4 SMART
CY 146 251 1.3e-2 SMART
low complexity region 347 417 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000232422
AA Change: N134Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display mild monocytosis, decreased bleeding time, faster clot lysis, and abnormal blood coagulation; however, wound healing is normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 C A 11: 110,036,439 (GRCm39) V557F possibly damaging Het
Abi3 A T 11: 95,732,851 (GRCm39) L41* probably null Het
Actn1 C A 12: 80,221,229 (GRCm39) probably null Het
Adamts15 G T 9: 30,813,358 (GRCm39) R936S probably benign Het
Angel2 T C 1: 190,665,068 (GRCm39) S22P probably benign Het
Ank2 T G 3: 126,740,470 (GRCm39) probably benign Het
Astn1 A G 1: 158,337,563 (GRCm39) D423G probably damaging Het
Casp9 A G 4: 141,523,849 (GRCm39) D78G probably damaging Het
Cbr4 A G 8: 61,940,887 (GRCm39) D2G probably benign Het
Ccdc8 T A 7: 16,730,506 (GRCm39) L665H probably damaging Het
Cdh23 T A 10: 60,167,105 (GRCm39) N1847I probably damaging Het
Cnst T C 1: 179,437,440 (GRCm39) W335R probably benign Het
Ddr2 T A 1: 169,832,671 (GRCm39) I130F probably benign Het
Dnah2 C T 11: 69,391,665 (GRCm39) A677T probably benign Het
Dzip3 C A 16: 48,772,205 (GRCm39) W488L probably damaging Het
Ephb3 T G 16: 21,040,763 (GRCm39) I637S probably damaging Het
Etv3 A G 3: 87,436,671 (GRCm39) D142G probably benign Het
Fabp5 C T 3: 10,081,149 (GRCm39) T126I probably benign Het
Fam13b A C 18: 34,627,827 (GRCm39) Y125D probably damaging Het
Fsip2 C A 2: 82,822,471 (GRCm39) P6068Q probably damaging Het
Gm11232 A G 4: 71,674,905 (GRCm39) F199S possibly damaging Het
Gm5493 A G 17: 22,967,034 (GRCm39) K57E probably benign Het
Gm7334 A G 17: 51,006,265 (GRCm39) M184V probably benign Het
Gm9894 T C 13: 67,911,954 (GRCm39) noncoding transcript Het
Gpd2 T A 2: 57,254,525 (GRCm39) N674K probably benign Het
H2-M10.6 A G 17: 37,123,959 (GRCm39) Y141C probably damaging Het
Heatr5a C T 12: 51,931,110 (GRCm39) E1796K probably benign Het
Hexim2 A G 11: 103,029,118 (GRCm39) T57A probably benign Het
Hsd17b12 T C 2: 93,864,322 (GRCm39) T262A probably damaging Het
Irak3 G T 10: 119,979,042 (GRCm39) P470T probably damaging Het
Itgbl1 A T 14: 124,083,977 (GRCm39) D285V probably damaging Het
Kcp A T 6: 29,502,863 (GRCm39) V164E probably benign Het
Klhdc7b T A 15: 89,272,589 (GRCm39) M1157K probably damaging Het
Lcor G A 19: 41,571,986 (GRCm39) G247D possibly damaging Het
Mdc1 G A 17: 36,159,525 (GRCm39) G635D probably benign Het
Mdc1 A G 17: 36,168,464 (GRCm39) K1690R probably benign Het
Mpp3 A T 11: 101,909,365 (GRCm39) probably benign Het
Ncor2 G T 5: 125,097,075 (GRCm39) H2285N probably benign Het
Neb T A 2: 52,147,839 (GRCm39) T2727S probably benign Het
Nkx6-2 T C 7: 139,161,483 (GRCm39) D234G possibly damaging Het
Nlrp9c T C 7: 26,084,150 (GRCm39) I476M probably benign Het
Nrsn1 T G 13: 25,437,355 (GRCm39) Q191P probably damaging Het
Or14j10 A T 17: 37,934,858 (GRCm39) S223T possibly damaging Het
Or1e30 C T 11: 73,678,378 (GRCm39) L205F probably benign Het
Or51ag1 T A 7: 103,156,006 (GRCm39) H49L probably benign Het
Patl1 T G 19: 11,914,718 (GRCm39) L623R probably damaging Het
Pdc T C 1: 150,209,117 (GRCm39) I200T probably benign Het
Pdzk1 A G 3: 96,775,742 (GRCm39) D370G probably benign Het
Pglyrp3 A T 3: 91,938,841 (GRCm39) I339F probably damaging Het
Plxnb1 T C 9: 108,945,679 (GRCm39) V2070A probably damaging Het
Poln G A 5: 34,266,775 (GRCm39) R461C probably damaging Het
Prl2b1 C A 13: 27,567,491 (GRCm39) V218L probably damaging Het
Pygl T C 12: 70,263,428 (GRCm39) D55G probably damaging Het
Rif1 C G 2: 51,985,856 (GRCm39) L614V probably damaging Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rsrp1 T C 4: 134,651,692 (GRCm39) F152S probably damaging Het
Sim2 T C 16: 93,898,110 (GRCm39) S115P probably damaging Het
Slc17a1 T A 13: 24,059,593 (GRCm39) I108K possibly damaging Het
Slc30a8 A G 15: 52,189,054 (GRCm39) D223G probably damaging Het
Slc39a4 A T 15: 76,500,342 (GRCm39) N69K probably benign Het
Slc51a T G 16: 32,298,584 (GRCm39) T58P probably damaging Het
Slc7a14 T C 3: 31,278,261 (GRCm39) H448R probably benign Het
Smc3 G A 19: 53,613,594 (GRCm39) probably null Het
Sox6 A T 7: 115,085,863 (GRCm39) D659E probably damaging Het
Stard9 GCCC GCC 2: 120,524,196 (GRCm39) probably null Het
Tsr1 C T 11: 74,791,119 (GRCm39) probably null Het
Ttc12 T C 9: 49,354,422 (GRCm39) K565E probably damaging Het
Ube4b A T 4: 149,452,768 (GRCm39) V386E probably benign Het
Ush2a T A 1: 188,460,293 (GRCm39) probably null Het
Usp5 C A 6: 124,794,576 (GRCm39) probably benign Het
Vmn1r216 T C 13: 23,284,105 (GRCm39) F263L probably benign Het
Vmn2r88 T A 14: 51,655,606 (GRCm39) L606* probably null Het
Wee2 T A 6: 40,426,554 (GRCm39) probably null Het
Zfhx3 T C 8: 109,519,159 (GRCm39) Y94H probably damaging Het
Zfp385c G A 11: 100,523,594 (GRCm39) P120L probably benign Het
Zscan4-ps3 T C 7: 11,344,228 (GRCm39) F62S probably damaging Het
Other mutations in Hrg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Hrg APN 16 22,777,909 (GRCm39) critical splice acceptor site probably null
IGL02795:Hrg APN 16 22,776,303 (GRCm39) unclassified probably benign
R0042:Hrg UTSW 16 22,779,886 (GRCm39) unclassified probably benign
R0184:Hrg UTSW 16 22,772,521 (GRCm39) critical splice donor site probably null
R1147:Hrg UTSW 16 22,779,754 (GRCm39) missense probably damaging 0.99
R1147:Hrg UTSW 16 22,779,754 (GRCm39) missense probably damaging 0.99
R1733:Hrg UTSW 16 22,769,997 (GRCm39) missense probably damaging 1.00
R1828:Hrg UTSW 16 22,774,853 (GRCm39) missense probably damaging 1.00
R1919:Hrg UTSW 16 22,773,207 (GRCm39) missense probably damaging 1.00
R2104:Hrg UTSW 16 22,774,949 (GRCm39) missense probably benign 0.09
R2281:Hrg UTSW 16 22,780,059 (GRCm39) unclassified probably benign
R2447:Hrg UTSW 16 22,779,898 (GRCm39) unclassified probably benign
R3962:Hrg UTSW 16 22,774,825 (GRCm39) missense possibly damaging 0.85
R3963:Hrg UTSW 16 22,774,825 (GRCm39) missense possibly damaging 0.85
R4571:Hrg UTSW 16 22,779,972 (GRCm39) unclassified probably benign
R4903:Hrg UTSW 16 22,779,901 (GRCm39) unclassified probably benign
R4904:Hrg UTSW 16 22,770,000 (GRCm39) missense probably benign 0.03
R5236:Hrg UTSW 16 22,780,263 (GRCm39) unclassified probably benign
R6054:Hrg UTSW 16 22,772,412 (GRCm39) missense probably benign 0.05
R6207:Hrg UTSW 16 22,773,288 (GRCm39) critical splice donor site probably null
R6374:Hrg UTSW 16 22,779,742 (GRCm39) missense probably damaging 0.98
R7516:Hrg UTSW 16 22,780,048 (GRCm39) missense unknown
R7606:Hrg UTSW 16 22,769,873 (GRCm39) start codon destroyed probably null 0.01
R8190:Hrg UTSW 16 22,779,793 (GRCm39) missense unknown
R8349:Hrg UTSW 16 22,780,286 (GRCm39) missense unknown
R8449:Hrg UTSW 16 22,780,286 (GRCm39) missense unknown
R8973:Hrg UTSW 16 22,777,968 (GRCm39) missense probably benign 0.22
R8998:Hrg UTSW 16 22,772,455 (GRCm39) missense probably damaging 0.99
R9334:Hrg UTSW 16 22,780,061 (GRCm39) missense unknown
Z1177:Hrg UTSW 16 22,772,462 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGGTATTGTCACAGTCCAC -3'
(R):5'- TCTTTAAGTGAGGTATGCCAGAGG -3'

Sequencing Primer
(F):5'- CACTTAAACAGGTGTTCTCATGAGGG -3'
(R):5'- CCAGAGGCAAGGAGCTGTG -3'
Posted On 2017-06-26