Mutagenetix > Incidental Mutation

Incidental Mutation 'R6020:Dzip3'

478899

Institutional Source

Beutler Lab

Gene Symbol

Dzip3

Ensembl Gene

ENSMUSG00000064061

Gene Name

DAZ interacting protein 3, zinc finger

Synonyms

2A-HUB, 6430549P11Rik, 2310047C04Rik

Accession Numbers

Genbank: NM_001110017.1, NM_027341.2; Ensembl: ENSMUST00000121869

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6020 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

48924232-48994165 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 48951842 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Leucine at position 488 (W488L)

Ref Sequence

ENSEMBL: ENSMUSP00000113344 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114516] [ENSMUST00000121869]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000114516

SMART Domains

Protein: ENSMUSP00000110161
Gene: ENSMUSG00000064061

Domain	Start	End	E-Value	Type
low complexity region	451	472	N/A	INTRINSIC
coiled coil region	548	568	N/A	INTRINSIC
coiled coil region	599	650	N/A	INTRINSIC
low complexity region	743	754	N/A	INTRINSIC
low complexity region	883	891	N/A	INTRINSIC
RING	938	977	2.09e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000121869
AA Change: W488L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113344
Gene: ENSMUSG00000064061
AA Change: W488L

Domain	Start	End	E-Value	Type
low complexity region	657	678	N/A	INTRINSIC
coiled coil region	754	774	N/A	INTRINSIC
coiled coil region	805	856	N/A	INTRINSIC
low complexity region	949	960	N/A	INTRINSIC
low complexity region	1089	1097	N/A	INTRINSIC
RING	1144	1183	2.09e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133377

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU-indcued allele exhibit embryonic lethality. [provided by MGI curators]

Allele List at MGI

All alleles(23) : Gene trapped(23)

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	C	A	11: 110,145,613	V557F	possibly damaging	Het
Abi3	A	T	11: 95,842,025	L41*	probably null	Het
Actn1	C	A	12: 80,174,455		probably null	Het
Adamts15	G	T	9: 30,902,062	R936S	probably benign	Het
Angel2	T	C	1: 190,932,871	S22P	probably benign	Het
Ank2	T	G	3: 126,946,821		probably benign	Het
Astn1	A	G	1: 158,509,993	D423G	probably damaging	Het
Casp9	A	G	4: 141,796,538	D78G	probably damaging	Het
Cbr4	A	G	8: 61,487,853	D2G	probably benign	Het
Ccdc8	T	A	7: 16,996,581	L665H	probably damaging	Het
Cdh23	T	A	10: 60,331,326	N1847I	probably damaging	Het
Cnst	T	C	1: 179,609,875	W335R	probably benign	Het
Ddr2	T	A	1: 170,005,102	I130F	probably benign	Het
Dnah2	C	T	11: 69,500,839	A677T	probably benign	Het
Ephb3	T	G	16: 21,222,013	I637S	probably damaging	Het
Etv3	A	G	3: 87,529,364	D142G	probably benign	Het
Fabp5	C	T	3: 10,016,089	T126I	probably benign	Het
Fam13b	A	C	18: 34,494,774	Y125D	probably damaging	Het
Fsip2	C	A	2: 82,992,127	P6068Q	probably damaging	Het
Gm11232	A	G	4: 71,756,668	F199S	possibly damaging	Het
Gm340	G	A	19: 41,583,547	G247D	possibly damaging	Het
Gm5493	A	G	17: 22,748,061	K57E	probably benign	Het
Gm7334	A	G	17: 50,699,237	M184V	probably benign	Het
Gm9894	T	C	13: 67,763,835		noncoding transcript	Het
Gpd2	T	A	2: 57,364,513	N674K	probably benign	Het
H2-M10.6	A	G	17: 36,813,067	Y141C	probably damaging	Het
Heatr5a	C	T	12: 51,884,327	E1796K	probably benign	Het
Hexim2	A	G	11: 103,138,292	T57A	probably benign	Het
Hrg	A	T	16: 22,954,518	N134Y	probably damaging	Het
Hsd17b12	T	C	2: 94,033,977	T262A	probably damaging	Het
Irak3	G	T	10: 120,143,137	P470T	probably damaging	Het
Itgbl1	A	T	14: 123,846,565	D285V	probably damaging	Het
Kcp	A	T	6: 29,502,864	V164E	probably benign	Het
Klhdc7b	T	A	15: 89,388,386	M1157K	probably damaging	Het
Mdc1	G	A	17: 35,848,633	G635D	probably benign	Het
Mdc1	A	G	17: 35,857,572	K1690R	probably benign	Het
Mpp3	A	T	11: 102,018,539		probably benign	Het
Ncor2	G	T	5: 125,020,011	H2285N	probably benign	Het
Neb	T	A	2: 52,257,827	T2727S	probably benign	Het
Nkx6-2	T	C	7: 139,581,567	D234G	possibly damaging	Het
Nlrp9c	T	C	7: 26,384,725	I476M	probably benign	Het
Nrsn1	T	G	13: 25,253,372	Q191P	probably damaging	Het
Olfr116	A	T	17: 37,623,967	S223T	possibly damaging	Het
Olfr390	C	T	11: 73,787,552	L205F	probably benign	Het
Olfr610	T	A	7: 103,506,799	H49L	probably benign	Het
Patl1	T	G	19: 11,937,354	L623R	probably damaging	Het
Pdc	T	C	1: 150,333,366	I200T	probably benign	Het
Pdzk1	A	G	3: 96,868,426	D370G	probably benign	Het
Pglyrp3	A	T	3: 92,031,534	I339F	probably damaging	Het
Plxnb1	T	C	9: 109,116,611	V2070A	probably damaging	Het
Poln	G	A	5: 34,109,431	R461C	probably damaging	Het
Prl2b1	C	A	13: 27,383,508	V218L	probably damaging	Het
Pygl	T	C	12: 70,216,654	D55G	probably damaging	Het
Rif1	C	G	2: 52,095,844	L614V	probably damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
RP24-351P7.8	T	C	7: 11,610,301	F62S	probably damaging	Het
Rsrp1	T	C	4: 134,924,381	F152S	probably damaging	Het
Sim2	T	C	16: 94,097,251	S115P	probably damaging	Het
Slc17a1	T	A	13: 23,875,610	I108K	possibly damaging	Het
Slc30a8	A	G	15: 52,325,658	D223G	probably damaging	Het
Slc39a4	A	T	15: 76,616,142	N69K	probably benign	Het
Slc51a	T	G	16: 32,479,766	T58P	probably damaging	Het
Slc7a14	T	C	3: 31,224,112	H448R	probably benign	Het
Smc3	G	A	19: 53,625,163		probably null	Het
Sox6	A	T	7: 115,486,628	D659E	probably damaging	Het
Stard9	GCCC	GCC	2: 120,693,715		probably null	Het
Tsr1	C	T	11: 74,900,293		probably null	Het
Ttc12	T	C	9: 49,443,122	K565E	probably damaging	Het
Ube4b	A	T	4: 149,368,311	V386E	probably benign	Het
Ush2a	T	A	1: 188,728,096		probably null	Het
Usp5	C	A	6: 124,817,613		probably benign	Het
Vmn1r216	T	C	13: 23,099,935	F263L	probably benign	Het
Vmn2r88	T	A	14: 51,418,149	L606*	probably null	Het
Wee2	T	A	6: 40,449,620		probably null	Het
Zfhx3	T	C	8: 108,792,527	Y94H	probably damaging	Het
Zfp385c	G	A	11: 100,632,768	P120L	probably benign	Het

Other mutations in Dzip3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00825:Dzip3	APN	16	48928415	missense	probably damaging	1.00
IGL00931:Dzip3	APN	16	48935497	critical splice donor site	probably null
IGL01109:Dzip3	APN	16	48929674	missense	probably benign	0.27
IGL01121:Dzip3	APN	16	48944881	missense	probably benign	0.10
IGL01328:Dzip3	APN	16	48972258	missense	probably damaging	1.00
IGL01729:Dzip3	APN	16	48928363	missense	possibly damaging	0.78
IGL02044:Dzip3	APN	16	48948427	missense	possibly damaging	0.90
IGL02051:Dzip3	APN	16	48972254	missense	probably benign	0.01
IGL02115:Dzip3	APN	16	48948485	missense	probably benign	0.00
IGL02125:Dzip3	APN	16	48927596	missense	probably damaging	1.00
IGL02136:Dzip3	APN	16	48927582	missense	possibly damaging	0.94
IGL02244:Dzip3	APN	16	48980988	missense	probably benign	0.01
IGL02253:Dzip3	APN	16	48944924	missense	probably benign	0.34
IGL02412:Dzip3	APN	16	48958457	missense	probably benign	0.00
IGL02452:Dzip3	APN	16	48938537	splice site	probably benign
IGL02481:Dzip3	APN	16	48975551	splice site	probably benign
IGL02499:Dzip3	APN	16	48933850	missense	probably damaging	1.00
IGL02511:Dzip3	APN	16	48936980	missense	possibly damaging	0.75
IGL02519:Dzip3	APN	16	48928396	missense	probably damaging	1.00
IGL02610:Dzip3	APN	16	48951653	missense	probably damaging	1.00
IGL03129:Dzip3	APN	16	48942083	missense	possibly damaging	0.51
IGL03342:Dzip3	APN	16	48929623	missense	probably damaging	0.98
IGL03493:Dzip3	APN	16	48951696	missense	probably benign	0.32
corvette	UTSW	16	48927540	critical splice donor site	probably null
dazwick	UTSW	16	48958465	missense	possibly damaging	0.90
1mM(1):Dzip3	UTSW	16	48951557	missense	probably damaging	1.00
PIT4651001:Dzip3	UTSW	16	48944878	missense	probably benign
R0313:Dzip3	UTSW	16	48937061	missense	probably damaging	0.99
R0483:Dzip3	UTSW	16	48947713	missense	possibly damaging	0.94
R0504:Dzip3	UTSW	16	48959643	splice site	probably benign
R0744:Dzip3	UTSW	16	48959675	missense	probably damaging	1.00
R0800:Dzip3	UTSW	16	48953808	splice site	probably benign
R0927:Dzip3	UTSW	16	48975477	missense	probably damaging	0.99
R0931:Dzip3	UTSW	16	48951558	missense	probably damaging	1.00
R1170:Dzip3	UTSW	16	48961208	missense	probably damaging	1.00
R1203:Dzip3	UTSW	16	48951817	missense	probably damaging	1.00
R1205:Dzip3	UTSW	16	48951681	missense	probably damaging	1.00
R1442:Dzip3	UTSW	16	48945622	missense	probably benign	0.19
R1526:Dzip3	UTSW	16	48937006	missense	probably damaging	1.00
R1560:Dzip3	UTSW	16	48951540	splice site	probably null
R1585:Dzip3	UTSW	16	48977878	splice site	probably benign
R1682:Dzip3	UTSW	16	48958417	critical splice donor site	probably null
R1957:Dzip3	UTSW	16	48927593	missense	probably damaging	1.00
R2472:Dzip3	UTSW	16	48953787	missense	possibly damaging	0.85
R2571:Dzip3	UTSW	16	48972218	splice site	probably null
R3040:Dzip3	UTSW	16	48928324	missense	probably damaging	1.00
R3081:Dzip3	UTSW	16	48927558	missense	probably damaging	1.00
R3615:Dzip3	UTSW	16	48937063	missense	probably damaging	1.00
R3616:Dzip3	UTSW	16	48937063	missense	probably damaging	1.00
R3786:Dzip3	UTSW	16	48975543	missense	probably benign	0.08
R3851:Dzip3	UTSW	16	48950013	missense	possibly damaging	0.94
R4097:Dzip3	UTSW	16	48958489	nonsense	probably null
R4371:Dzip3	UTSW	16	48943455	critical splice donor site	probably null
R4612:Dzip3	UTSW	16	48952040	nonsense	probably null
R4671:Dzip3	UTSW	16	48979590	nonsense	probably null
R4695:Dzip3	UTSW	16	48951561	missense	probably damaging	1.00
R4696:Dzip3	UTSW	16	48925969	unclassified	probably benign
R4769:Dzip3	UTSW	16	48938474	missense	probably damaging	0.97
R5063:Dzip3	UTSW	16	48953754	nonsense	probably null
R5321:Dzip3	UTSW	16	48957675	missense	possibly damaging	0.95
R5764:Dzip3	UTSW	16	48927361	intron	probably benign
R6218:Dzip3	UTSW	16	48958465	missense	possibly damaging	0.90
R6300:Dzip3	UTSW	16	48951807	missense	probably damaging	1.00
R6365:Dzip3	UTSW	16	48931273	missense	probably damaging	0.96
R6778:Dzip3	UTSW	16	48982083	missense	probably benign	0.00
R6915:Dzip3	UTSW	16	48942125	missense	possibly damaging	0.72
R7047:Dzip3	UTSW	16	48982126	missense	probably benign	0.04
R7059:Dzip3	UTSW	16	48980942	missense	probably benign	0.34
R7095:Dzip3	UTSW	16	48927790	missense	probably benign
R7227:Dzip3	UTSW	16	48951569	missense	probably damaging	0.99
R7319:Dzip3	UTSW	16	48927540	critical splice donor site	probably null
R7436:Dzip3	UTSW	16	48951989	missense	probably damaging	1.00
R7469:Dzip3	UTSW	16	48944879	missense	probably benign
R7526:Dzip3	UTSW	16	48975474	missense	probably damaging	0.99
R7964:Dzip3	UTSW	16	48951905	missense	probably damaging	1.00
R8131:Dzip3	UTSW	16	48933793	critical splice donor site	probably null
R8188:Dzip3	UTSW	16	48952136	missense	probably damaging	1.00
R8209:Dzip3	UTSW	16	48977944	missense	probably damaging	1.00
R8750:Dzip3	UTSW	16	48980975	missense	probably damaging	0.99
R8758:Dzip3	UTSW	16	48977937	missense	probably damaging	1.00
R8784:Dzip3	UTSW	16	48931265	missense	probably damaging	0.99
R9086:Dzip3	UTSW	16	48961130	missense	possibly damaging	0.81
R9157:Dzip3	UTSW	16	48927761	missense	probably benign
R9170:Dzip3	UTSW	16	48952038	missense	possibly damaging	0.74
R9762:Dzip3	UTSW	16	48928344	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGTTTCATCCCAAGGCGCAG -3'
(R):5'- CAAATATTTGATGAGGCTATGCCACC -3'

Sequencing Primer
(F):5'- TCCCAAGGCGCAGAAGAATATCAG -3'
(R):5'- AAGAGCTGCTTATACACAAGAATG -3'

Posted On

2017-06-26