Incidental Mutation 'R6020:Smc3'
ID 478910
Institutional Source Beutler Lab
Gene Symbol Smc3
Ensembl Gene ENSMUSG00000024974
Gene Name structural maintenance of chromosomes 3
Synonyms Cspg6, Bamacan, Mmip1, SmcD
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6020 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 53588827-53634262 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 53613594 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025930]
AlphaFold Q9CW03
PDB Structure SMC hinge heterodimer (Mouse) [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000025930
SMART Domains Protein: ENSMUSP00000025930
Gene: ENSMUSG00000024974

DomainStartEndE-ValueType
Pfam:AAA_23 5 359 5.4e-10 PFAM
SMC_hinge 530 643 1.85e-23 SMART
low complexity region 684 711 N/A INTRINSIC
Blast:SMC_hinge 712 804 3e-49 BLAST
low complexity region 805 818 N/A INTRINSIC
Blast:SMC_hinge 819 870 3e-23 BLAST
Blast:INB 898 1174 2e-52 BLAST
PDB:1XEW|Y 1032 1212 6e-30 PDB
SCOP:d1e69a_ 1114 1193 2e-9 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the SMC3 subfamily of SMC proteins. The encoded protein occurs in certain cell types as either an intracellular, nuclear protein or a secreted protein. The nuclear form, known as structural maintenance of chromosomes 3, is a component of the multimeric cohesin complex that holds together sister chromatids during mitosis, enabling proper chromosome segregation. Post-translational modification of the encoded protein by the addition of chondroitin sulfate chains gives rise to the secreted proteoglycan bamacan, an abundant basement membrane protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality. Mice heterozygous for this allele exhibit partial postnatal lethality, decreased body weight, abnormal craniofacial morphology, and increased T cell number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 C A 11: 110,036,439 (GRCm39) V557F possibly damaging Het
Abi3 A T 11: 95,732,851 (GRCm39) L41* probably null Het
Actn1 C A 12: 80,221,229 (GRCm39) probably null Het
Adamts15 G T 9: 30,813,358 (GRCm39) R936S probably benign Het
Angel2 T C 1: 190,665,068 (GRCm39) S22P probably benign Het
Ank2 T G 3: 126,740,470 (GRCm39) probably benign Het
Astn1 A G 1: 158,337,563 (GRCm39) D423G probably damaging Het
Casp9 A G 4: 141,523,849 (GRCm39) D78G probably damaging Het
Cbr4 A G 8: 61,940,887 (GRCm39) D2G probably benign Het
Ccdc8 T A 7: 16,730,506 (GRCm39) L665H probably damaging Het
Cdh23 T A 10: 60,167,105 (GRCm39) N1847I probably damaging Het
Cnst T C 1: 179,437,440 (GRCm39) W335R probably benign Het
Ddr2 T A 1: 169,832,671 (GRCm39) I130F probably benign Het
Dnah2 C T 11: 69,391,665 (GRCm39) A677T probably benign Het
Dzip3 C A 16: 48,772,205 (GRCm39) W488L probably damaging Het
Ephb3 T G 16: 21,040,763 (GRCm39) I637S probably damaging Het
Etv3 A G 3: 87,436,671 (GRCm39) D142G probably benign Het
Fabp5 C T 3: 10,081,149 (GRCm39) T126I probably benign Het
Fam13b A C 18: 34,627,827 (GRCm39) Y125D probably damaging Het
Fsip2 C A 2: 82,822,471 (GRCm39) P6068Q probably damaging Het
Gm11232 A G 4: 71,674,905 (GRCm39) F199S possibly damaging Het
Gm5493 A G 17: 22,967,034 (GRCm39) K57E probably benign Het
Gm7334 A G 17: 51,006,265 (GRCm39) M184V probably benign Het
Gm9894 T C 13: 67,911,954 (GRCm39) noncoding transcript Het
Gpd2 T A 2: 57,254,525 (GRCm39) N674K probably benign Het
H2-M10.6 A G 17: 37,123,959 (GRCm39) Y141C probably damaging Het
Heatr5a C T 12: 51,931,110 (GRCm39) E1796K probably benign Het
Hexim2 A G 11: 103,029,118 (GRCm39) T57A probably benign Het
Hrg A T 16: 22,773,268 (GRCm39) N134Y probably damaging Het
Hsd17b12 T C 2: 93,864,322 (GRCm39) T262A probably damaging Het
Irak3 G T 10: 119,979,042 (GRCm39) P470T probably damaging Het
Itgbl1 A T 14: 124,083,977 (GRCm39) D285V probably damaging Het
Kcp A T 6: 29,502,863 (GRCm39) V164E probably benign Het
Klhdc7b T A 15: 89,272,589 (GRCm39) M1157K probably damaging Het
Lcor G A 19: 41,571,986 (GRCm39) G247D possibly damaging Het
Mdc1 G A 17: 36,159,525 (GRCm39) G635D probably benign Het
Mdc1 A G 17: 36,168,464 (GRCm39) K1690R probably benign Het
Mpp3 A T 11: 101,909,365 (GRCm39) probably benign Het
Ncor2 G T 5: 125,097,075 (GRCm39) H2285N probably benign Het
Neb T A 2: 52,147,839 (GRCm39) T2727S probably benign Het
Nkx6-2 T C 7: 139,161,483 (GRCm39) D234G possibly damaging Het
Nlrp9c T C 7: 26,084,150 (GRCm39) I476M probably benign Het
Nrsn1 T G 13: 25,437,355 (GRCm39) Q191P probably damaging Het
Or14j10 A T 17: 37,934,858 (GRCm39) S223T possibly damaging Het
Or1e30 C T 11: 73,678,378 (GRCm39) L205F probably benign Het
Or51ag1 T A 7: 103,156,006 (GRCm39) H49L probably benign Het
Patl1 T G 19: 11,914,718 (GRCm39) L623R probably damaging Het
Pdc T C 1: 150,209,117 (GRCm39) I200T probably benign Het
Pdzk1 A G 3: 96,775,742 (GRCm39) D370G probably benign Het
Pglyrp3 A T 3: 91,938,841 (GRCm39) I339F probably damaging Het
Plxnb1 T C 9: 108,945,679 (GRCm39) V2070A probably damaging Het
Poln G A 5: 34,266,775 (GRCm39) R461C probably damaging Het
Prl2b1 C A 13: 27,567,491 (GRCm39) V218L probably damaging Het
Pygl T C 12: 70,263,428 (GRCm39) D55G probably damaging Het
Rif1 C G 2: 51,985,856 (GRCm39) L614V probably damaging Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rsrp1 T C 4: 134,651,692 (GRCm39) F152S probably damaging Het
Sim2 T C 16: 93,898,110 (GRCm39) S115P probably damaging Het
Slc17a1 T A 13: 24,059,593 (GRCm39) I108K possibly damaging Het
Slc30a8 A G 15: 52,189,054 (GRCm39) D223G probably damaging Het
Slc39a4 A T 15: 76,500,342 (GRCm39) N69K probably benign Het
Slc51a T G 16: 32,298,584 (GRCm39) T58P probably damaging Het
Slc7a14 T C 3: 31,278,261 (GRCm39) H448R probably benign Het
Sox6 A T 7: 115,085,863 (GRCm39) D659E probably damaging Het
Stard9 GCCC GCC 2: 120,524,196 (GRCm39) probably null Het
Tsr1 C T 11: 74,791,119 (GRCm39) probably null Het
Ttc12 T C 9: 49,354,422 (GRCm39) K565E probably damaging Het
Ube4b A T 4: 149,452,768 (GRCm39) V386E probably benign Het
Ush2a T A 1: 188,460,293 (GRCm39) probably null Het
Usp5 C A 6: 124,794,576 (GRCm39) probably benign Het
Vmn1r216 T C 13: 23,284,105 (GRCm39) F263L probably benign Het
Vmn2r88 T A 14: 51,655,606 (GRCm39) L606* probably null Het
Wee2 T A 6: 40,426,554 (GRCm39) probably null Het
Zfhx3 T C 8: 109,519,159 (GRCm39) Y94H probably damaging Het
Zfp385c G A 11: 100,523,594 (GRCm39) P120L probably benign Het
Zscan4-ps3 T C 7: 11,344,228 (GRCm39) F62S probably damaging Het
Other mutations in Smc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Smc3 APN 19 53,617,758 (GRCm39) missense probably damaging 0.99
IGL01300:Smc3 APN 19 53,630,283 (GRCm39) splice site probably benign
IGL02136:Smc3 APN 19 53,624,147 (GRCm39) missense probably benign 0.02
IGL02216:Smc3 APN 19 53,610,275 (GRCm39) missense probably damaging 1.00
IGL02473:Smc3 APN 19 53,624,879 (GRCm39) missense probably benign 0.06
IGL02797:Smc3 APN 19 53,627,189 (GRCm39) missense probably benign 0.03
IGL02959:Smc3 APN 19 53,611,988 (GRCm39) missense probably benign 0.00
IGL03343:Smc3 APN 19 53,602,273 (GRCm39) missense probably damaging 1.00
Bits UTSW 19 53,611,649 (GRCm39) critical splice donor site probably null
Pieces UTSW 19 53,617,802 (GRCm39) missense probably damaging 0.99
Smithereens UTSW 19 53,630,362 (GRCm39) missense probably damaging 1.00
R0081:Smc3 UTSW 19 53,589,993 (GRCm39) splice site probably benign
R0940:Smc3 UTSW 19 53,629,340 (GRCm39) missense probably benign 0.10
R1248:Smc3 UTSW 19 53,622,509 (GRCm39) missense probably benign 0.01
R1661:Smc3 UTSW 19 53,613,496 (GRCm39) missense probably benign 0.08
R1779:Smc3 UTSW 19 53,627,800 (GRCm39) missense probably benign 0.02
R2046:Smc3 UTSW 19 53,627,845 (GRCm39) missense probably benign 0.00
R2073:Smc3 UTSW 19 53,619,964 (GRCm39) missense probably benign 0.08
R2074:Smc3 UTSW 19 53,619,964 (GRCm39) missense probably benign 0.08
R3077:Smc3 UTSW 19 53,616,322 (GRCm39) missense probably benign 0.16
R4962:Smc3 UTSW 19 53,619,948 (GRCm39) missense probably damaging 0.99
R5684:Smc3 UTSW 19 53,629,235 (GRCm39) missense probably benign 0.00
R6169:Smc3 UTSW 19 53,622,517 (GRCm39) missense probably benign 0.02
R6221:Smc3 UTSW 19 53,630,362 (GRCm39) missense probably damaging 1.00
R6258:Smc3 UTSW 19 53,616,162 (GRCm39) splice site probably null
R6960:Smc3 UTSW 19 53,617,802 (GRCm39) missense probably damaging 0.99
R7048:Smc3 UTSW 19 53,617,682 (GRCm39) missense probably benign 0.01
R7148:Smc3 UTSW 19 53,630,326 (GRCm39) missense possibly damaging 0.93
R7157:Smc3 UTSW 19 53,630,329 (GRCm39) missense probably damaging 1.00
R7805:Smc3 UTSW 19 53,629,390 (GRCm39) missense probably benign 0.26
R7968:Smc3 UTSW 19 53,611,649 (GRCm39) critical splice donor site probably null
R8066:Smc3 UTSW 19 53,603,576 (GRCm39) missense probably damaging 1.00
R8202:Smc3 UTSW 19 53,617,123 (GRCm39) missense possibly damaging 0.94
R8472:Smc3 UTSW 19 53,617,142 (GRCm39) missense probably benign 0.02
R8683:Smc3 UTSW 19 53,629,616 (GRCm39) missense possibly damaging 0.50
R8827:Smc3 UTSW 19 53,611,085 (GRCm39) missense probably benign 0.01
R9072:Smc3 UTSW 19 53,617,200 (GRCm39) missense probably benign 0.00
R9073:Smc3 UTSW 19 53,617,200 (GRCm39) missense probably benign 0.00
R9355:Smc3 UTSW 19 53,622,544 (GRCm39) critical splice donor site probably null
R9428:Smc3 UTSW 19 53,617,150 (GRCm39) missense possibly damaging 0.48
X0026:Smc3 UTSW 19 53,613,551 (GRCm39) missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TCGAGGAAGCCAGTTTACG -3'
(R):5'- CATTTTAAGAACAGCATGGTGGAG -3'

Sequencing Primer
(F):5'- GGAAGCCAGTTTACGTCAAAAG -3'
(R):5'- CCTGGTCTATACAGTAAGTTCCAGG -3'
Posted On 2017-06-26