Incidental Mutation 'R6021:Sardh'
ID478915
Institutional Source Beutler Lab
Gene Symbol Sardh
Ensembl Gene ENSMUSG00000009614
Gene Namesarcosine dehydrogenase
Synonyms
MMRRC Submission 044194-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R6021 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location27188393-27248337 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27189643 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 879 (V879A)
Ref Sequence ENSEMBL: ENSMUSP00000099950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102886]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000091224
Predicted Effect probably benign
Transcript: ENSMUST00000102886
AA Change: V879A

PolyPhen 2 Score 0.445 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099950
Gene: ENSMUSG00000009614
AA Change: V879A

DomainStartEndE-ValueType
Pfam:DAO 69 428 1.7e-63 PFAM
Pfam:FAO_M 431 486 9.2e-22 PFAM
Pfam:GCV_T 489 799 3.1e-64 PFAM
Pfam:GCV_T_C 807 904 4.7e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170435
Meta Mutation Damage Score 0.1137 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 94% (61/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme localized to the mitochondrial matrix which catalyzes the oxidative demethylation of sarcosine. This enzyme is distinct from another mitochondrial matrix enzyme, dimethylglycine dehydrogenase, which catalyzes a reaction resulting in the formation of sarcosine. Mutations in this gene are associated with sarcosinemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,061,082 T338A probably damaging Het
4933427I04Rik A G 4: 123,860,716 D141G possibly damaging Het
A1bg T C 15: 60,919,864 E241G possibly damaging Het
Abca13 G A 11: 9,290,465 W776* probably null Het
Akr1b10 T A 6: 34,392,374 probably null Het
Atf7 T C 15: 102,557,473 D84G probably benign Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Azi2 T A 9: 118,047,419 M1K probably null Het
Boc T A 16: 44,488,654 M832L probably benign Het
Brix1 C T 15: 10,476,589 R267H probably benign Het
Cacna1s T C 1: 136,106,487 L1050P probably benign Het
Celsr2 G T 3: 108,401,245 P1789T probably benign Het
Crebbp G A 16: 4,085,418 R1986C probably damaging Het
Crtam T A 9: 40,990,181 I150F probably damaging Het
Crybg1 G T 10: 43,997,538 S1191R probably damaging Het
D630045J12Rik T C 6: 38,190,617 T1017A probably benign Het
Dnah10 A G 5: 124,736,984 E396G probably damaging Het
Enpp5 A T 17: 44,085,319 Y374F probably benign Het
Fzd4 G A 7: 89,407,734 A330T probably benign Het
Gabra5 A G 7: 57,507,992 S25P probably benign Het
Ggps1 T C 13: 14,054,004 Y198C probably damaging Het
Gm13101 A T 4: 143,965,766 C222S probably benign Het
Gm13762 G T 2: 88,973,032 Y286* probably null Het
Gm3173 A C 14: 4,514,873 D39A probably damaging Het
Gm4869 A T 5: 140,469,679 M347L probably damaging Het
Grm2 T C 9: 106,650,800 D295G probably damaging Het
H2-Bl T G 17: 36,081,274 E182A probably damaging Het
Igfbp5 A G 1: 72,863,204 M208T possibly damaging Het
Ildr2 T A 1: 166,303,604 M343K possibly damaging Het
Loxhd1 A T 18: 77,412,250 D120V probably damaging Het
Lrp1 T C 10: 127,578,014 D1175G probably damaging Het
Lrp1b C A 2: 41,344,427 D1171Y probably benign Het
Lrrc9 A T 12: 72,469,231 I563F probably damaging Het
Ltbp3 A T 19: 5,753,680 T798S probably benign Het
Msantd4 T A 9: 4,384,063 V128E probably benign Het
Mtf2 A G 5: 108,081,137 I69V possibly damaging Het
Myh10 T A 11: 68,808,862 S1712T possibly damaging Het
Mylk3 A G 8: 85,364,813 V121A possibly damaging Het
Ndufaf4 A G 4: 24,901,760 N100D probably benign Het
Notch2 T C 3: 98,121,972 F1017S probably damaging Het
Olfr1197 G T 2: 88,728,950 Y216* probably null Het
Olfr1253 A C 2: 89,752,121 S236A probably benign Het
P2ry2 T C 7: 100,998,400 T233A probably benign Het
Paip1 T "TTA,TT" 13: 119,457,135 probably null Het
Pak1 T C 7: 97,854,463 S2P probably damaging Het
Pde8b A T 13: 95,026,162 D817E possibly damaging Het
Pfdn2 C A 1: 171,345,770 probably benign Het
Raver1 A G 9: 21,076,622 L606P probably damaging Het
Robo3 C T 9: 37,422,533 W668* probably null Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Rxfp2 A G 5: 150,063,737 N337S possibly damaging Het
Samhd1 T C 2: 157,120,554 probably null Het
Slc4a4 A T 5: 89,040,402 probably benign Het
Slc6a11 T C 6: 114,230,051 L332P probably damaging Het
Tas2r135 T C 6: 42,406,387 Y287H probably damaging Het
Tlr4 T A 4: 66,840,866 I632N probably damaging Het
Tmem145 C T 7: 25,308,845 probably null Het
Trmt61a C A 12: 111,680,977 F169L probably damaging Het
Trp53tg5 T A 2: 164,471,471 I95L probably benign Het
Vmn1r85 T C 7: 13,084,689 E176G probably benign Het
Vmn2r75 T C 7: 86,171,612 D38G probably benign Het
Vmn2r99 A G 17: 19,377,948 Y78C probably damaging Het
Wrb T C 16: 96,145,678 probably benign Het
Zfp964 G T 8: 69,663,092 S114I unknown Het
Other mutations in Sardh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01110:Sardh APN 2 27215113 missense probably benign 0.07
IGL01686:Sardh APN 2 27189613 missense probably damaging 1.00
IGL01868:Sardh APN 2 27227147 missense probably benign 0.35
IGL02167:Sardh APN 2 27191975 missense probably damaging 0.98
IGL02272:Sardh APN 2 27224991 missense probably benign 0.00
IGL02870:Sardh APN 2 27235491 missense possibly damaging 0.93
IGL03117:Sardh APN 2 27239446 missense probably damaging 1.00
PIT4305001:Sardh UTSW 2 27228314 missense probably damaging 1.00
PIT4791001:Sardh UTSW 2 27197648 missense probably damaging 1.00
R0265:Sardh UTSW 2 27227066 splice site probably benign
R0781:Sardh UTSW 2 27191919 missense possibly damaging 0.82
R1110:Sardh UTSW 2 27191919 missense possibly damaging 0.82
R1242:Sardh UTSW 2 27235563 missense probably damaging 1.00
R1404:Sardh UTSW 2 27239461 missense probably damaging 1.00
R1404:Sardh UTSW 2 27239461 missense probably damaging 1.00
R1514:Sardh UTSW 2 27197690 missense possibly damaging 0.95
R1565:Sardh UTSW 2 27242719 missense probably damaging 1.00
R1832:Sardh UTSW 2 27235569 missense possibly damaging 0.95
R1836:Sardh UTSW 2 27215182 missense possibly damaging 0.65
R1997:Sardh UTSW 2 27244397 missense probably damaging 0.97
R2006:Sardh UTSW 2 27228339 missense probably damaging 1.00
R2046:Sardh UTSW 2 27215082 missense possibly damaging 0.95
R2242:Sardh UTSW 2 27235515 missense possibly damaging 0.93
R2897:Sardh UTSW 2 27189547 missense probably benign 0.00
R4332:Sardh UTSW 2 27215114 missense possibly damaging 0.85
R4807:Sardh UTSW 2 27189527 missense probably benign 0.00
R4841:Sardh UTSW 2 27191955 missense probably benign 0.09
R4842:Sardh UTSW 2 27191955 missense probably benign 0.09
R4856:Sardh UTSW 2 27244477 missense probably benign 0.02
R4936:Sardh UTSW 2 27228241 splice site probably null
R5089:Sardh UTSW 2 27239613 critical splice donor site probably null
R5110:Sardh UTSW 2 27189547 missense probably benign 0.00
R5257:Sardh UTSW 2 27244259 missense probably damaging 0.98
R5406:Sardh UTSW 2 27211084 missense possibly damaging 0.72
R5450:Sardh UTSW 2 27239698 missense possibly damaging 0.65
R5594:Sardh UTSW 2 27220723 missense probably damaging 1.00
R5870:Sardh UTSW 2 27220641 critical splice donor site probably null
R6014:Sardh UTSW 2 27197528 critical splice donor site probably null
R6470:Sardh UTSW 2 27244372 missense probably damaging 1.00
R6577:Sardh UTSW 2 27218855 missense possibly damaging 0.95
R6750:Sardh UTSW 2 27228257 missense probably benign 0.04
R7035:Sardh UTSW 2 27230842 missense probably damaging 1.00
R7162:Sardh UTSW 2 27197690 missense possibly damaging 0.95
R7256:Sardh UTSW 2 27218812 missense probably benign
R7692:Sardh UTSW 2 27197639 missense probably benign 0.01
R7709:Sardh UTSW 2 27241517 missense possibly damaging 0.62
R7884:Sardh UTSW 2 27239371 missense probably damaging 0.99
R7967:Sardh UTSW 2 27239371 missense probably damaging 0.99
X0011:Sardh UTSW 2 27242746 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTTATTCTGGGTCTCAGGAC -3'
(R):5'- ACAGGGCACATGAGCTGTTG -3'

Sequencing Primer
(F):5'- CACAAGGCTGTGTGTGCAG -3'
(R):5'- GCACATGAGCTGTTGTTCTTTG -3'
Posted On2017-06-26