Incidental Mutation 'R6021:Olfr1253'
ID478919
Institutional Source Beutler Lab
Gene Symbol Olfr1253
Ensembl Gene ENSMUSG00000075075
Gene Nameolfactory receptor 1253
SynonymsMOR231-19P, MOR231-18, MOR231-19P, GA_x6K02T2Q125-51193814-51192857, Olfr1253-ps1, Olfr1559-ps1
MMRRC Submission 044194-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6021 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location89749467-89757090 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 89752121 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 236 (S236A)
Ref Sequence ENSEMBL: ENSMUSP00000151024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099765] [ENSMUST00000213484] [ENSMUST00000215185] [ENSMUST00000215988]
Predicted Effect probably benign
Transcript: ENSMUST00000099765
AA Change: S236A

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000097353
Gene: ENSMUSG00000075075
AA Change: S236A

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 9.2e-46 PFAM
Pfam:7tm_1 39 285 1.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213484
AA Change: S236A

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000215185
AA Change: S236A

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000215988
AA Change: S236A

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 94% (61/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,061,082 T338A probably damaging Het
4933427I04Rik A G 4: 123,860,716 D141G possibly damaging Het
A1bg T C 15: 60,919,864 E241G possibly damaging Het
Abca13 G A 11: 9,290,465 W776* probably null Het
Akr1b10 T A 6: 34,392,374 probably null Het
Atf7 T C 15: 102,557,473 D84G probably benign Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Azi2 T A 9: 118,047,419 M1K probably null Het
Boc T A 16: 44,488,654 M832L probably benign Het
Brix1 C T 15: 10,476,589 R267H probably benign Het
Cacna1s T C 1: 136,106,487 L1050P probably benign Het
Celsr2 G T 3: 108,401,245 P1789T probably benign Het
Crebbp G A 16: 4,085,418 R1986C probably damaging Het
Crtam T A 9: 40,990,181 I150F probably damaging Het
Crybg1 G T 10: 43,997,538 S1191R probably damaging Het
D630045J12Rik T C 6: 38,190,617 T1017A probably benign Het
Dnah10 A G 5: 124,736,984 E396G probably damaging Het
Enpp5 A T 17: 44,085,319 Y374F probably benign Het
Fzd4 G A 7: 89,407,734 A330T probably benign Het
Gabra5 A G 7: 57,507,992 S25P probably benign Het
Ggps1 T C 13: 14,054,004 Y198C probably damaging Het
Gm13101 A T 4: 143,965,766 C222S probably benign Het
Gm13762 G T 2: 88,973,032 Y286* probably null Het
Gm3173 A C 14: 4,514,873 D39A probably damaging Het
Gm4869 A T 5: 140,469,679 M347L probably damaging Het
Grm2 T C 9: 106,650,800 D295G probably damaging Het
H2-Bl T G 17: 36,081,274 E182A probably damaging Het
Igfbp5 A G 1: 72,863,204 M208T possibly damaging Het
Ildr2 T A 1: 166,303,604 M343K possibly damaging Het
Loxhd1 A T 18: 77,412,250 D120V probably damaging Het
Lrp1 T C 10: 127,578,014 D1175G probably damaging Het
Lrp1b C A 2: 41,344,427 D1171Y probably benign Het
Lrrc9 A T 12: 72,469,231 I563F probably damaging Het
Ltbp3 A T 19: 5,753,680 T798S probably benign Het
Msantd4 T A 9: 4,384,063 V128E probably benign Het
Mtf2 A G 5: 108,081,137 I69V possibly damaging Het
Myh10 T A 11: 68,808,862 S1712T possibly damaging Het
Mylk3 A G 8: 85,364,813 V121A possibly damaging Het
Ndufaf4 A G 4: 24,901,760 N100D probably benign Het
Notch2 T C 3: 98,121,972 F1017S probably damaging Het
Olfr1197 G T 2: 88,728,950 Y216* probably null Het
P2ry2 T C 7: 100,998,400 T233A probably benign Het
Paip1 T "TTA,TT" 13: 119,457,135 probably null Het
Pak1 T C 7: 97,854,463 S2P probably damaging Het
Pde8b A T 13: 95,026,162 D817E possibly damaging Het
Pfdn2 C A 1: 171,345,770 probably benign Het
Raver1 A G 9: 21,076,622 L606P probably damaging Het
Robo3 C T 9: 37,422,533 W668* probably null Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Rxfp2 A G 5: 150,063,737 N337S possibly damaging Het
Samhd1 T C 2: 157,120,554 probably null Het
Sardh A G 2: 27,189,643 V879A probably benign Het
Slc4a4 A T 5: 89,040,402 probably benign Het
Slc6a11 T C 6: 114,230,051 L332P probably damaging Het
Tas2r135 T C 6: 42,406,387 Y287H probably damaging Het
Tlr4 T A 4: 66,840,866 I632N probably damaging Het
Tmem145 C T 7: 25,308,845 probably null Het
Trmt61a C A 12: 111,680,977 F169L probably damaging Het
Trp53tg5 T A 2: 164,471,471 I95L probably benign Het
Vmn1r85 T C 7: 13,084,689 E176G probably benign Het
Vmn2r75 T C 7: 86,171,612 D38G probably benign Het
Vmn2r99 A G 17: 19,377,948 Y78C probably damaging Het
Wrb T C 16: 96,145,678 probably benign Het
Zfp964 G T 8: 69,663,092 S114I unknown Het
Other mutations in Olfr1253
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01938:Olfr1253 APN 2 89752348 missense probably benign 0.12
IGL02287:Olfr1253 APN 2 89752614 nonsense probably null
IGL03149:Olfr1253 APN 2 89752828 unclassified probably null
R0017:Olfr1253 UTSW 2 89752021 missense possibly damaging 0.67
R1466:Olfr1253 UTSW 2 89752267 missense probably damaging 1.00
R1466:Olfr1253 UTSW 2 89752267 missense probably damaging 1.00
R1584:Olfr1253 UTSW 2 89752267 missense probably damaging 1.00
R2008:Olfr1253 UTSW 2 89752073 missense possibly damaging 0.57
R2484:Olfr1253 UTSW 2 89752234 missense probably benign 0.00
R5135:Olfr1253 UTSW 2 89751895 missense possibly damaging 0.67
R5648:Olfr1253 UTSW 2 89752073 missense probably damaging 0.99
R6952:Olfr1253 UTSW 2 89752627 missense possibly damaging 0.64
R7039:Olfr1253 UTSW 2 89752751 missense probably benign 0.01
R7088:Olfr1253 UTSW 2 89752099 missense probably benign 0.01
R7443:Olfr1253 UTSW 2 89751941 missense probably benign 0.01
R7444:Olfr1253 UTSW 2 89752759 missense probably benign 0.01
R7538:Olfr1253 UTSW 2 89752321 missense probably damaging 1.00
R7594:Olfr1253 UTSW 2 89752562 missense probably benign 0.32
R7818:Olfr1253 UTSW 2 89751944 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TTGGACTTAACATTTTCTGCAGGAG -3'
(R):5'- CCACTTTGGCTGTGACATATACC -3'

Sequencing Primer
(F):5'- AACATTTTCTGCAGGAGCTTTTC -3'
(R):5'- GGCTGTGACATATACCCATTATTAC -3'
Posted On2017-06-26