Incidental Mutation 'R6021:Mtf2'
ID478930
Institutional Source Beutler Lab
Gene Symbol Mtf2
Ensembl Gene ENSMUSG00000029267
Gene Namemetal response element binding transcription factor 2
SynonymsPcl2, C76717, 9230112N11Rik, M96
MMRRC Submission 044194-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.885) question?
Stock #R6021 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location108065674-108109004 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108081137 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 69 (I69V)
Ref Sequence ENSEMBL: ENSMUSP00000128797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081567] [ENSMUST00000112626] [ENSMUST00000124195] [ENSMUST00000134026] [ENSMUST00000143412] [ENSMUST00000170319] [ENSMUST00000172045]
Predicted Effect probably benign
Transcript: ENSMUST00000081567
AA Change: I69V

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000080278
Gene: ENSMUSG00000029267
AA Change: I69V

DomainStartEndE-ValueType
TUDOR 44 101 4.09e-13 SMART
PHD 104 155 3.37e-11 SMART
PHD 203 253 1.23e-4 SMART
low complexity region 496 508 N/A INTRINSIC
Pfam:Mtf2_C 544 591 2.8e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112626
AA Change: I69V

PolyPhen 2 Score 0.582 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108245
Gene: ENSMUSG00000029267
AA Change: I69V

DomainStartEndE-ValueType
TUDOR 44 101 4.09e-13 SMART
PHD 104 155 3.37e-11 SMART
PHD 203 253 1.23e-4 SMART
low complexity region 439 451 N/A INTRINSIC
Pfam:Mtf2_C 485 535 5.8e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000124195
AA Change: N70S

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000126297
Gene: ENSMUSG00000029267
AA Change: N70S

DomainStartEndE-ValueType
PDB:2EQJ|A 36 70 2e-17 PDB
Blast:TUDOR 44 75 7e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131291
Predicted Effect possibly damaging
Transcript: ENSMUST00000134026
AA Change: I69V

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128797
Gene: ENSMUSG00000029267
AA Change: I69V

DomainStartEndE-ValueType
TUDOR 44 101 4.09e-13 SMART
PHD 104 155 3.37e-11 SMART
PHD 203 253 1.23e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141592
Predicted Effect probably benign
Transcript: ENSMUST00000143412
AA Change: I69V

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000132596
Gene: ENSMUSG00000029267
AA Change: I69V

DomainStartEndE-ValueType
TUDOR 44 101 1.22e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163823
Predicted Effect probably benign
Transcript: ENSMUST00000170319
SMART Domains Protein: ENSMUSP00000130536
Gene: ENSMUSG00000029267

DomainStartEndE-ValueType
PHD 1 37 6.4e-3 SMART
PHD 85 135 1.23e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172045
SMART Domains Protein: ENSMUSP00000126452
Gene: ENSMUSG00000029267

DomainStartEndE-ValueType
PHD 2 50 2.18e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198662
Meta Mutation Damage Score 0.0835 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 94% (61/65)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit vertebral transformation and delayed replicative senescence in MEFs. Mice homozygous for one gene trap allele exhibit postnatal lethality, vertebral transformation and delayed replicative senescence in MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,061,082 T338A probably damaging Het
4933427I04Rik A G 4: 123,860,716 D141G possibly damaging Het
A1bg T C 15: 60,919,864 E241G possibly damaging Het
Abca13 G A 11: 9,290,465 W776* probably null Het
Akr1b10 T A 6: 34,392,374 probably null Het
Atf7 T C 15: 102,557,473 D84G probably benign Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Azi2 T A 9: 118,047,419 M1K probably null Het
Boc T A 16: 44,488,654 M832L probably benign Het
Brix1 C T 15: 10,476,589 R267H probably benign Het
Cacna1s T C 1: 136,106,487 L1050P probably benign Het
Celsr2 G T 3: 108,401,245 P1789T probably benign Het
Crebbp G A 16: 4,085,418 R1986C probably damaging Het
Crtam T A 9: 40,990,181 I150F probably damaging Het
Crybg1 G T 10: 43,997,538 S1191R probably damaging Het
D630045J12Rik T C 6: 38,190,617 T1017A probably benign Het
Dnah10 A G 5: 124,736,984 E396G probably damaging Het
Enpp5 A T 17: 44,085,319 Y374F probably benign Het
Fzd4 G A 7: 89,407,734 A330T probably benign Het
Gabra5 A G 7: 57,507,992 S25P probably benign Het
Ggps1 T C 13: 14,054,004 Y198C probably damaging Het
Gm13101 A T 4: 143,965,766 C222S probably benign Het
Gm13762 G T 2: 88,973,032 Y286* probably null Het
Gm3173 A C 14: 4,514,873 D39A probably damaging Het
Gm4869 A T 5: 140,469,679 M347L probably damaging Het
Grm2 T C 9: 106,650,800 D295G probably damaging Het
H2-Bl T G 17: 36,081,274 E182A probably damaging Het
Igfbp5 A G 1: 72,863,204 M208T possibly damaging Het
Ildr2 T A 1: 166,303,604 M343K possibly damaging Het
Loxhd1 A T 18: 77,412,250 D120V probably damaging Het
Lrp1 T C 10: 127,578,014 D1175G probably damaging Het
Lrp1b C A 2: 41,344,427 D1171Y probably benign Het
Lrrc9 A T 12: 72,469,231 I563F probably damaging Het
Ltbp3 A T 19: 5,753,680 T798S probably benign Het
Msantd4 T A 9: 4,384,063 V128E probably benign Het
Myh10 T A 11: 68,808,862 S1712T possibly damaging Het
Mylk3 A G 8: 85,364,813 V121A possibly damaging Het
Ndufaf4 A G 4: 24,901,760 N100D probably benign Het
Notch2 T C 3: 98,121,972 F1017S probably damaging Het
Olfr1197 G T 2: 88,728,950 Y216* probably null Het
Olfr1253 A C 2: 89,752,121 S236A probably benign Het
P2ry2 T C 7: 100,998,400 T233A probably benign Het
Paip1 T "TTA,TT" 13: 119,457,135 probably null Het
Pak1 T C 7: 97,854,463 S2P probably damaging Het
Pde8b A T 13: 95,026,162 D817E possibly damaging Het
Pfdn2 C A 1: 171,345,770 probably benign Het
Raver1 A G 9: 21,076,622 L606P probably damaging Het
Robo3 C T 9: 37,422,533 W668* probably null Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Rxfp2 A G 5: 150,063,737 N337S possibly damaging Het
Samhd1 T C 2: 157,120,554 probably null Het
Sardh A G 2: 27,189,643 V879A probably benign Het
Slc4a4 A T 5: 89,040,402 probably benign Het
Slc6a11 T C 6: 114,230,051 L332P probably damaging Het
Tas2r135 T C 6: 42,406,387 Y287H probably damaging Het
Tlr4 T A 4: 66,840,866 I632N probably damaging Het
Tmem145 C T 7: 25,308,845 probably null Het
Trmt61a C A 12: 111,680,977 F169L probably damaging Het
Trp53tg5 T A 2: 164,471,471 I95L probably benign Het
Vmn1r85 T C 7: 13,084,689 E176G probably benign Het
Vmn2r75 T C 7: 86,171,612 D38G probably benign Het
Vmn2r99 A G 17: 19,377,948 Y78C probably damaging Het
Wrb T C 16: 96,145,678 probably benign Het
Zfp964 G T 8: 69,663,092 S114I unknown Het
Other mutations in Mtf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Mtf2 APN 5 108106890 missense probably damaging 1.00
IGL01367:Mtf2 APN 5 108104457 missense probably benign 0.44
IGL01452:Mtf2 APN 5 108080943 missense probably damaging 1.00
IGL01459:Mtf2 APN 5 108080943 missense probably damaging 1.00
IGL01460:Mtf2 APN 5 108080943 missense probably damaging 1.00
IGL01809:Mtf2 APN 5 108087325 missense probably benign 0.27
IGL03166:Mtf2 APN 5 108106720 missense probably benign 0.28
R0667:Mtf2 UTSW 5 108104503 missense probably damaging 1.00
R1533:Mtf2 UTSW 5 108092129 missense probably damaging 1.00
R1664:Mtf2 UTSW 5 108104476 missense probably damaging 1.00
R1723:Mtf2 UTSW 5 108088070 missense probably damaging 1.00
R2154:Mtf2 UTSW 5 108080931 missense possibly damaging 0.79
R2213:Mtf2 UTSW 5 108100914 missense possibly damaging 0.95
R3904:Mtf2 UTSW 5 108081000 missense probably damaging 1.00
R4320:Mtf2 UTSW 5 108087025 missense probably damaging 1.00
R4560:Mtf2 UTSW 5 108086989 splice site probably null
R4764:Mtf2 UTSW 5 108093352 missense probably benign 0.43
R4989:Mtf2 UTSW 5 108073028 intron probably benign
R5305:Mtf2 UTSW 5 108104499 missense possibly damaging 0.84
R5356:Mtf2 UTSW 5 108106610 missense possibly damaging 0.92
R5528:Mtf2 UTSW 5 108094157 missense probably damaging 1.00
R7164:Mtf2 UTSW 5 108093369 missense possibly damaging 0.53
R7426:Mtf2 UTSW 5 108100970 missense probably benign
R7822:Mtf2 UTSW 5 108080877 nonsense probably null
Z1088:Mtf2 UTSW 5 108087329 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCAGCATGTAAATTTGAAGAGGGTC -3'
(R):5'- AAACGTCTTATACATGCTACCCAG -3'

Sequencing Primer
(F):5'- CAAGATGTCTTAGCTAGATGGTCAG -3'
(R):5'- GCTACCCAGCCACTGAAG -3'
Posted On2017-06-26