Incidental Mutation 'R6021:D630045J12Rik'
ID478934
Institutional Source Beutler Lab
Gene Symbol D630045J12Rik
Ensembl Gene ENSMUSG00000063455
Gene NameRIKEN cDNA D630045J12 gene
Synonyms
MMRRC Submission 044194-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6021 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location38123174-38254009 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38190617 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1017 (T1017A)
Ref Sequence ENSEMBL: ENSMUSP00000130121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117556] [ENSMUST00000169256]
Predicted Effect probably benign
Transcript: ENSMUST00000117556
AA Change: T876A

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000112939
Gene: ENSMUSG00000063455
AA Change: T876A

DomainStartEndE-ValueType
low complexity region 190 203 N/A INTRINSIC
low complexity region 290 301 N/A INTRINSIC
low complexity region 414 431 N/A INTRINSIC
low complexity region 528 573 N/A INTRINSIC
low complexity region 581 598 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
Pfam:DUF3827 746 1412 N/A PFAM
low complexity region 1480 1500 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149557
Predicted Effect probably benign
Transcript: ENSMUST00000169256
AA Change: T1017A

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000130121
Gene: ENSMUSG00000063455
AA Change: T1017A

DomainStartEndE-ValueType
signal peptide 1 45 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
low complexity region 693 710 N/A INTRINSIC
low complexity region 807 852 N/A INTRINSIC
low complexity region 860 877 N/A INTRINSIC
transmembrane domain 987 1009 N/A INTRINSIC
Pfam:DUF3827 1026 1691 7.1e-301 PFAM
low complexity region 1759 1779 N/A INTRINSIC
Meta Mutation Damage Score 0.0591 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 94% (61/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the UPF0606 family. This gene has been found to be fused to the BRAF oncogene in many cases of pilocytic astrocytoma. The fusion results from 2Mb tandem duplications at 7q34. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,061,082 T338A probably damaging Het
4933427I04Rik A G 4: 123,860,716 D141G possibly damaging Het
A1bg T C 15: 60,919,864 E241G possibly damaging Het
Abca13 G A 11: 9,290,465 W776* probably null Het
Akr1b10 T A 6: 34,392,374 probably null Het
Atf7 T C 15: 102,557,473 D84G probably benign Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Azi2 T A 9: 118,047,419 M1K probably null Het
Boc T A 16: 44,488,654 M832L probably benign Het
Brix1 C T 15: 10,476,589 R267H probably benign Het
Cacna1s T C 1: 136,106,487 L1050P probably benign Het
Celsr2 G T 3: 108,401,245 P1789T probably benign Het
Crebbp G A 16: 4,085,418 R1986C probably damaging Het
Crtam T A 9: 40,990,181 I150F probably damaging Het
Crybg1 G T 10: 43,997,538 S1191R probably damaging Het
Dnah10 A G 5: 124,736,984 E396G probably damaging Het
Enpp5 A T 17: 44,085,319 Y374F probably benign Het
Fzd4 G A 7: 89,407,734 A330T probably benign Het
Gabra5 A G 7: 57,507,992 S25P probably benign Het
Ggps1 T C 13: 14,054,004 Y198C probably damaging Het
Gm13101 A T 4: 143,965,766 C222S probably benign Het
Gm13762 G T 2: 88,973,032 Y286* probably null Het
Gm3173 A C 14: 4,514,873 D39A probably damaging Het
Gm4869 A T 5: 140,469,679 M347L probably damaging Het
Grm2 T C 9: 106,650,800 D295G probably damaging Het
H2-Bl T G 17: 36,081,274 E182A probably damaging Het
Igfbp5 A G 1: 72,863,204 M208T possibly damaging Het
Ildr2 T A 1: 166,303,604 M343K possibly damaging Het
Loxhd1 A T 18: 77,412,250 D120V probably damaging Het
Lrp1 T C 10: 127,578,014 D1175G probably damaging Het
Lrp1b C A 2: 41,344,427 D1171Y probably benign Het
Lrrc9 A T 12: 72,469,231 I563F probably damaging Het
Ltbp3 A T 19: 5,753,680 T798S probably benign Het
Msantd4 T A 9: 4,384,063 V128E probably benign Het
Mtf2 A G 5: 108,081,137 I69V possibly damaging Het
Myh10 T A 11: 68,808,862 S1712T possibly damaging Het
Mylk3 A G 8: 85,364,813 V121A possibly damaging Het
Ndufaf4 A G 4: 24,901,760 N100D probably benign Het
Notch2 T C 3: 98,121,972 F1017S probably damaging Het
Olfr1197 G T 2: 88,728,950 Y216* probably null Het
Olfr1253 A C 2: 89,752,121 S236A probably benign Het
P2ry2 T C 7: 100,998,400 T233A probably benign Het
Paip1 T "TTA,TT" 13: 119,457,135 probably null Het
Pak1 T C 7: 97,854,463 S2P probably damaging Het
Pde8b A T 13: 95,026,162 D817E possibly damaging Het
Pfdn2 C A 1: 171,345,770 probably benign Het
Raver1 A G 9: 21,076,622 L606P probably damaging Het
Robo3 C T 9: 37,422,533 W668* probably null Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Rxfp2 A G 5: 150,063,737 N337S possibly damaging Het
Samhd1 T C 2: 157,120,554 probably null Het
Sardh A G 2: 27,189,643 V879A probably benign Het
Slc4a4 A T 5: 89,040,402 probably benign Het
Slc6a11 T C 6: 114,230,051 L332P probably damaging Het
Tas2r135 T C 6: 42,406,387 Y287H probably damaging Het
Tlr4 T A 4: 66,840,866 I632N probably damaging Het
Tmem145 C T 7: 25,308,845 probably null Het
Trmt61a C A 12: 111,680,977 F169L probably damaging Het
Trp53tg5 T A 2: 164,471,471 I95L probably benign Het
Vmn1r85 T C 7: 13,084,689 E176G probably benign Het
Vmn2r75 T C 7: 86,171,612 D38G probably benign Het
Vmn2r99 A G 17: 19,377,948 Y78C probably damaging Het
Wrb T C 16: 96,145,678 probably benign Het
Zfp964 G T 8: 69,663,092 S114I unknown Het
Other mutations in D630045J12Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:D630045J12Rik APN 6 38194930 missense probably benign 0.03
IGL01089:D630045J12Rik APN 6 38136963 missense probably benign
IGL01745:D630045J12Rik APN 6 38191720 missense probably damaging 0.99
IGL02069:D630045J12Rik APN 6 38184072 missense probably damaging 0.98
IGL02238:D630045J12Rik APN 6 38196394 missense probably benign
IGL02496:D630045J12Rik APN 6 38149705 missense probably damaging 1.00
IGL02675:D630045J12Rik APN 6 38195485 missense possibly damaging 0.93
IGL03030:D630045J12Rik APN 6 38149713 missense probably damaging 1.00
IGL03203:D630045J12Rik APN 6 38168221 missense probably damaging 0.98
IGL03205:D630045J12Rik APN 6 38147259 missense probably damaging 1.00
PIT4472001:D630045J12Rik UTSW 6 38178839 missense probably damaging 1.00
PIT4687001:D630045J12Rik UTSW 6 38195101 missense probably benign
R0021:D630045J12Rik UTSW 6 38183967 nonsense probably null
R0021:D630045J12Rik UTSW 6 38183967 nonsense probably null
R0128:D630045J12Rik UTSW 6 38149771 splice site probably benign
R0130:D630045J12Rik UTSW 6 38149771 splice site probably benign
R0206:D630045J12Rik UTSW 6 38139450 missense probably damaging 0.99
R0208:D630045J12Rik UTSW 6 38139450 missense probably damaging 0.99
R0347:D630045J12Rik UTSW 6 38181392 missense probably damaging 0.97
R0396:D630045J12Rik UTSW 6 38196736 missense possibly damaging 0.85
R0538:D630045J12Rik UTSW 6 38191693 missense probably damaging 1.00
R0636:D630045J12Rik UTSW 6 38196778 missense probably benign
R0842:D630045J12Rik UTSW 6 38148465 missense probably damaging 1.00
R1120:D630045J12Rik UTSW 6 38194770 missense probably damaging 0.96
R1323:D630045J12Rik UTSW 6 38148508 missense probably damaging 1.00
R1323:D630045J12Rik UTSW 6 38148508 missense probably damaging 1.00
R1412:D630045J12Rik UTSW 6 38195760 missense probably benign 0.03
R1546:D630045J12Rik UTSW 6 38190655 missense probably damaging 1.00
R1649:D630045J12Rik UTSW 6 38181431 missense probably damaging 0.98
R1704:D630045J12Rik UTSW 6 38139427 missense probably benign 0.14
R1969:D630045J12Rik UTSW 6 38168143 missense probably damaging 1.00
R1971:D630045J12Rik UTSW 6 38168143 missense probably damaging 1.00
R2182:D630045J12Rik UTSW 6 38174147 critical splice donor site probably null
R2354:D630045J12Rik UTSW 6 38158091 missense possibly damaging 0.88
R2926:D630045J12Rik UTSW 6 38168171 missense probably damaging 1.00
R3768:D630045J12Rik UTSW 6 38142909 missense probably damaging 1.00
R3886:D630045J12Rik UTSW 6 38142698 missense possibly damaging 0.90
R4439:D630045J12Rik UTSW 6 38194761 missense probably benign 0.07
R4688:D630045J12Rik UTSW 6 38196657 missense possibly damaging 0.85
R4739:D630045J12Rik UTSW 6 38196036 missense possibly damaging 0.76
R4748:D630045J12Rik UTSW 6 38196841 missense possibly damaging 0.91
R4792:D630045J12Rik UTSW 6 38148340 missense probably damaging 1.00
R4794:D630045J12Rik UTSW 6 38194485 missense possibly damaging 0.90
R4947:D630045J12Rik UTSW 6 38148543 missense probably damaging 1.00
R4959:D630045J12Rik UTSW 6 38148367 missense possibly damaging 0.81
R4973:D630045J12Rik UTSW 6 38148367 missense possibly damaging 0.81
R5261:D630045J12Rik UTSW 6 38194620 missense probably benign
R5344:D630045J12Rik UTSW 6 38158228 missense probably damaging 1.00
R5488:D630045J12Rik UTSW 6 38196847 missense possibly damaging 0.85
R5489:D630045J12Rik UTSW 6 38196847 missense possibly damaging 0.85
R5605:D630045J12Rik UTSW 6 38191764 missense probably damaging 1.00
R5828:D630045J12Rik UTSW 6 38196367 missense possibly damaging 0.47
R5831:D630045J12Rik UTSW 6 38142657 missense possibly damaging 0.80
R5939:D630045J12Rik UTSW 6 38194969 missense possibly damaging 0.70
R6060:D630045J12Rik UTSW 6 38130864 missense probably damaging 1.00
R6081:D630045J12Rik UTSW 6 38142698 missense probably damaging 0.99
R6498:D630045J12Rik UTSW 6 38147197 nonsense probably null
R6930:D630045J12Rik UTSW 6 38158216 missense probably damaging 1.00
R7019:D630045J12Rik UTSW 6 38194635 missense probably benign 0.12
R7156:D630045J12Rik UTSW 6 38195029 missense possibly damaging 0.91
R7248:D630045J12Rik UTSW 6 38168263 missense probably damaging 1.00
R7249:D630045J12Rik UTSW 6 38136950 missense possibly damaging 0.95
R7250:D630045J12Rik UTSW 6 38142611 missense possibly damaging 0.80
R7376:D630045J12Rik UTSW 6 38174303 missense probably damaging 0.99
R7491:D630045J12Rik UTSW 6 38142666 missense possibly damaging 0.89
R7552:D630045J12Rik UTSW 6 38148448 missense probably damaging 0.99
R7560:D630045J12Rik UTSW 6 38196627 missense possibly damaging 0.72
R7593:D630045J12Rik UTSW 6 38195494 missense possibly damaging 0.93
R7624:D630045J12Rik UTSW 6 38149563 missense probably damaging 1.00
R7654:D630045J12Rik UTSW 6 38177701 missense probably damaging 1.00
R7950:D630045J12Rik UTSW 6 38181310 splice site probably null
Predicted Primers PCR Primer
(F):5'- GTGTGCACAATCCTCAGTTC -3'
(R):5'- TATCCAACAGGGTTTTCTCTAAGG -3'

Sequencing Primer
(F):5'- AGGTCTCAAGCTTGGTACCTTAAC -3'
(R):5'- ACAGGGTTTTCTCTAAGGTTGAATTG -3'
Posted On2017-06-26