Incidental Mutation 'R0512:Thsd7a'
ID47894
Institutional Source Beutler Lab
Gene Symbol Thsd7a
Ensembl Gene ENSMUSG00000032625
Gene Namethrombospondin, type I, domain containing 7A
SynonymsLOC330267
MMRRC Submission 038706-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0512 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location12311610-12749410 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12379605 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 940 (I940T)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119581] [ENSMUST00000172356]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046121
AA Change: I940T

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000040176
Gene: ENSMUSG00000032625
AA Change: I940T

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
TSP1 49 105 4.88e0 SMART
TSP1 186 236 1.58e-16 SMART
low complexity region 264 278 N/A INTRINSIC
low complexity region 290 304 N/A INTRINSIC
TSP1 352 408 9.98e-5 SMART
TSP1 415 499 3.14e0 SMART
TSP1 504 563 6.62e-1 SMART
TSP1 626 684 1.24e-9 SMART
TSP1 687 758 1.48e0 SMART
TSP1 763 820 6.24e-6 SMART
TSP1 898 948 7.31e-2 SMART
TSP1 1027 1084 1.2e-7 SMART
TSP1 1087 1152 5.82e-1 SMART
TSP1 1157 1209 4.24e-2 SMART
TSP1 1212 1273 1e0 SMART
TSP1 1278 1330 3.55e-10 SMART
TSP1 1331 1401 7.5e-2 SMART
TSP1 1406 1464 1.55e-1 SMART
transmembrane domain 1596 1618 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119581
AA Change: I940T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000113681
Gene: ENSMUSG00000032625
AA Change: I940T

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
TSP1 49 105 4.88e0 SMART
TSP1 186 236 1.58e-16 SMART
low complexity region 264 278 N/A INTRINSIC
low complexity region 290 304 N/A INTRINSIC
TSP1 352 408 9.98e-5 SMART
TSP1 415 499 3.14e0 SMART
TSP1 504 563 6.62e-1 SMART
TSP1 626 684 1.24e-9 SMART
TSP1 687 758 1.48e0 SMART
TSP1 763 820 6.24e-6 SMART
TSP1 898 948 7.31e-2 SMART
TSP1 1027 1082 9.09e-8 SMART
TSP1 1085 1150 5.82e-1 SMART
TSP1 1155 1207 4.24e-2 SMART
TSP1 1210 1271 1e0 SMART
TSP1 1276 1328 3.55e-10 SMART
TSP1 1329 1399 7.5e-2 SMART
TSP1 1404 1462 1.55e-1 SMART
transmembrane domain 1594 1616 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122369
SMART Domains Protein: ENSMUSP00000112503
Gene: ENSMUSG00000032625

DomainStartEndE-ValueType
TSP1 43 100 6.24e-6 SMART
TSP1 178 228 7.31e-2 SMART
Blast:TSP1 232 302 4e-26 BLAST
TSP1 307 362 9.09e-8 SMART
TSP1 365 430 5.82e-1 SMART
TSP1 435 487 4.24e-2 SMART
TSP1 490 551 1e0 SMART
TSP1 556 608 3.55e-10 SMART
TSP1 609 679 7.5e-2 SMART
TSP1 684 742 1.55e-1 SMART
transmembrane domain 874 896 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172356
AA Change: I940T

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000131662
Gene: ENSMUSG00000032625
AA Change: I940T

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
TSP1 49 105 4.88e0 SMART
TSP1 186 236 1.58e-16 SMART
low complexity region 264 278 N/A INTRINSIC
low complexity region 290 304 N/A INTRINSIC
TSP1 352 408 9.98e-5 SMART
TSP1 415 499 3.14e0 SMART
TSP1 504 563 6.62e-1 SMART
TSP1 626 684 1.24e-9 SMART
TSP1 687 758 1.48e0 SMART
TSP1 763 820 6.24e-6 SMART
TSP1 898 948 7.31e-2 SMART
TSP1 1027 1084 1.95e-7 SMART
TSP1 1087 1152 5.82e-1 SMART
TSP1 1157 1209 4.24e-2 SMART
TSP1 1212 1273 1e0 SMART
TSP1 1278 1330 3.55e-10 SMART
TSP1 1331 1401 7.5e-2 SMART
TSP1 1406 1464 1.55e-1 SMART
transmembrane domain 1596 1618 N/A INTRINSIC
Meta Mutation Damage Score 0.022 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (92/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found almost exclusively in endothelial cells from placenta and umbilical cord. The encoded protein appears to interact with alpha(V)beta(3) integrin and paxillin to inhibit endothelial cell migration and tube formation. This protein may be involved in cytoskeletal organization. Variations in this gene may be associated with low bone mineral density in osteoporosis. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik T G 5: 114,863,508 M22R probably benign Het
Abca8b C A 11: 109,950,650 M1039I probably benign Het
Actn2 A T 13: 12,277,415 I653N probably damaging Het
Actr8 G T 14: 29,978,556 V31L probably benign Het
Adam30 T C 3: 98,162,125 C425R probably damaging Het
Armc1 A G 3: 19,149,495 V89A possibly damaging Het
Atr T C 9: 95,935,526 M2090T probably damaging Het
Braf T A 6: 39,664,989 probably benign Het
Cant1 A T 11: 118,411,265 N75K probably benign Het
Chd7 C T 4: 8,805,139 probably benign Het
Clec16a A G 16: 10,614,580 Y488C probably damaging Het
Col6a3 A T 1: 90,821,798 probably benign Het
Col9a2 T A 4: 121,054,307 M615K probably benign Het
D3Ertd254e T C 3: 36,166,113 C762R probably damaging Het
Dedd G A 1: 171,340,930 R228H probably damaging Het
Dhtkd1 C T 2: 5,904,091 D731N probably damaging Het
Ercc2 A G 7: 19,393,887 T651A probably damaging Het
Fam13a T A 6: 58,956,699 D302V probably damaging Het
Fam193a T C 5: 34,426,391 S19P probably damaging Het
Fam208a T C 14: 27,446,406 F302L probably damaging Het
Fam43a T C 16: 30,601,735 V379A possibly damaging Het
Fam57b C T 7: 126,827,623 R73C probably damaging Het
Fat1 C A 8: 44,951,332 Y373* probably null Het
Fbxl15 A C 19: 46,329,422 D181A probably damaging Het
Flt3 A T 5: 147,341,270 C831* probably null Het
Foxj3 T A 4: 119,585,836 probably benign Het
Glul T C 1: 153,905,386 probably benign Het
Gm16380 A T 9: 53,884,245 noncoding transcript Het
Gm7964 A T 7: 83,755,950 noncoding transcript Het
Hipk1 A G 3: 103,760,574 F559S possibly damaging Het
Hnf4g A T 3: 3,651,622 I284F probably damaging Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Icosl A G 10: 78,071,966 N120S possibly damaging Het
Ift172 A G 5: 31,285,477 V155A possibly damaging Het
Kdm4c A G 4: 74,333,794 E426G probably benign Het
Kif23 A G 9: 61,918,975 probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lama1 G A 17: 67,779,134 C1456Y possibly damaging Het
Lamc3 T A 2: 31,937,968 L1378Q probably damaging Het
Larp1b T A 3: 40,970,034 L121M probably benign Het
Lepr T A 4: 101,792,019 D872E probably damaging Het
Lepr A C 4: 101,814,704 D975A possibly damaging Het
Magi1 A G 6: 93,694,064 V1068A probably damaging Het
Malt1 T A 18: 65,458,200 N358K probably damaging Het
Mfap4 T A 11: 61,487,945 W240R probably damaging Het
Mis18a A G 16: 90,726,356 V84A possibly damaging Het
Mns1 A G 9: 72,449,471 E308G possibly damaging Het
Mpp2 C A 11: 102,062,290 L258F possibly damaging Het
Myh2 A G 11: 67,188,678 E987G probably damaging Het
Myof A G 19: 37,954,524 V702A possibly damaging Het
Nhs C A X: 161,837,359 R1467I probably damaging Het
Nrxn2 A G 19: 6,517,198 T1360A probably damaging Het
Obox6 A G 7: 15,833,949 I191T probably benign Het
Pacs2 G T 12: 113,050,927 R236L probably damaging Het
Pcdhb2 T G 18: 37,295,979 V335G probably damaging Het
Phyhipl T C 10: 70,568,918 I140M probably damaging Het
Pkhd1 T C 1: 20,310,514 probably benign Het
Ppp1r3b T G 8: 35,384,417 C137G probably damaging Het
Prdm13 T A 4: 21,678,490 I667F probably damaging Het
Prex2 A G 1: 11,199,933 M1281V probably benign Het
Rab40b A G 11: 121,359,586 F81L probably damaging Het
Rb1cc1 T C 1: 6,248,543 S729P probably damaging Het
Rcl1 A G 19: 29,128,097 D228G probably damaging Het
Rhbdf1 A T 11: 32,210,875 C19* probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf150 G A 8: 82,864,178 V57M probably benign Het
Rp9 A G 9: 22,458,719 F51L probably benign Het
Sav1 A T 12: 69,969,201 Y274* probably null Het
Scn4a A T 11: 106,345,677 D252E probably damaging Het
Scn5a T C 9: 119,550,658 T187A probably damaging Het
Sigirr T A 7: 141,092,420 D229V probably benign Het
Slc39a13 T C 2: 91,065,686 S157G possibly damaging Het
Slc6a20a A G 9: 123,660,406 S191P probably damaging Het
Sorl1 C A 9: 42,067,832 A457S probably benign Het
Spag5 A G 11: 78,319,586 probably benign Het
Spon1 A G 7: 113,836,833 E119G possibly damaging Het
Spred2 T A 11: 20,008,485 probably benign Het
Sprr3 T G 3: 92,457,477 Q20P possibly damaging Het
Strn3 A T 12: 51,627,183 F464L possibly damaging Het
Sun1 A G 5: 139,234,847 probably benign Het
Sypl2 A G 3: 108,226,170 W28R possibly damaging Het
Syt5 A T 7: 4,542,814 V150D probably damaging Het
Tnrc6a T A 7: 123,186,728 probably benign Het
Trp53 T A 11: 69,588,683 L203Q probably damaging Het
Tubgcp4 T C 2: 121,175,419 V96A probably benign Het
Usp17la A G 7: 104,861,039 T284A possibly damaging Het
Usp34 T C 11: 23,451,997 M2409T probably benign Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r56 A G 7: 12,715,423 I296T probably benign Het
Vmn2r67 A G 7: 85,150,692 V446A probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Other mutations in Thsd7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Thsd7a APN 6 12379659 splice site probably null
IGL00563:Thsd7a APN 6 12379659 splice site probably null
IGL00753:Thsd7a APN 6 12327529 missense probably damaging 1.00
IGL00835:Thsd7a APN 6 12554934 missense probably damaging 1.00
IGL01486:Thsd7a APN 6 12471080 missense probably damaging 1.00
IGL01730:Thsd7a APN 6 12554981 missense probably benign 0.05
IGL01931:Thsd7a APN 6 12504099 missense probably damaging 1.00
IGL01935:Thsd7a APN 6 12317419 missense probably damaging 1.00
IGL01978:Thsd7a APN 6 12331006 missense probably benign 0.01
IGL02233:Thsd7a APN 6 12555258 missense probably benign 0.00
IGL02354:Thsd7a APN 6 12348193 splice site probably benign
IGL02361:Thsd7a APN 6 12348193 splice site probably benign
IGL02375:Thsd7a APN 6 12343265 missense probably damaging 1.00
IGL02468:Thsd7a APN 6 12318171 missense probably damaging 0.98
IGL02616:Thsd7a APN 6 12408985 missense probably damaging 0.98
IGL02820:Thsd7a APN 6 12321072 missense probably damaging 1.00
IGL02858:Thsd7a APN 6 12500995 missense probably benign 0.16
IGL03074:Thsd7a APN 6 12324681 missense probably damaging 0.99
IGL03234:Thsd7a APN 6 12343178 missense probably damaging 1.00
IGL03244:Thsd7a APN 6 12504168 splice site probably benign
IGL03337:Thsd7a APN 6 12405174 missense probably damaging 1.00
PIT4354001:Thsd7a UTSW 6 12331927 critical splice donor site probably null
R0095:Thsd7a UTSW 6 12320970 missense probably damaging 0.99
R0127:Thsd7a UTSW 6 12554908 missense probably benign 0.01
R0142:Thsd7a UTSW 6 12418335 missense probably damaging 1.00
R0226:Thsd7a UTSW 6 12321900 missense possibly damaging 0.94
R0242:Thsd7a UTSW 6 12503916 missense probably benign 0.32
R0242:Thsd7a UTSW 6 12503916 missense probably benign 0.32
R0359:Thsd7a UTSW 6 12352031 missense probably damaging 1.00
R0365:Thsd7a UTSW 6 12321887 critical splice donor site probably null
R0504:Thsd7a UTSW 6 12379594 missense probably damaging 0.99
R0540:Thsd7a UTSW 6 12331542 splice site probably null
R0577:Thsd7a UTSW 6 12321048 missense possibly damaging 0.50
R0607:Thsd7a UTSW 6 12331542 splice site probably null
R0755:Thsd7a UTSW 6 12555369 missense probably damaging 1.00
R0771:Thsd7a UTSW 6 12327577 missense probably benign 0.09
R0780:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R0870:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R0871:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R0872:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R0873:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R1102:Thsd7a UTSW 6 12555702 missense possibly damaging 0.58
R1144:Thsd7a UTSW 6 12471027 splice site probably benign
R1265:Thsd7a UTSW 6 12317419 missense probably damaging 0.99
R1276:Thsd7a UTSW 6 12418370 missense probably damaging 1.00
R1381:Thsd7a UTSW 6 12555439 missense probably damaging 1.00
R1473:Thsd7a UTSW 6 12338622 missense probably benign 0.08
R1519:Thsd7a UTSW 6 12471175 missense probably benign 0.01
R1633:Thsd7a UTSW 6 12471104 nonsense probably null
R1659:Thsd7a UTSW 6 12504064 missense possibly damaging 0.73
R1769:Thsd7a UTSW 6 12555715 nonsense probably null
R1824:Thsd7a UTSW 6 12409042 splice site probably null
R1840:Thsd7a UTSW 6 12330974 missense probably benign 0.03
R1845:Thsd7a UTSW 6 12321041 missense probably damaging 1.00
R1874:Thsd7a UTSW 6 12555435 missense possibly damaging 0.76
R2023:Thsd7a UTSW 6 12327536 missense probably benign 0.16
R2039:Thsd7a UTSW 6 12408923 missense possibly damaging 0.77
R2058:Thsd7a UTSW 6 12318106 splice site probably benign
R2138:Thsd7a UTSW 6 12471073 nonsense probably null
R2155:Thsd7a UTSW 6 12379633 missense probably damaging 1.00
R2175:Thsd7a UTSW 6 12331944 missense possibly damaging 0.95
R2216:Thsd7a UTSW 6 12337268 missense possibly damaging 0.95
R2318:Thsd7a UTSW 6 12405147 missense probably damaging 1.00
R2375:Thsd7a UTSW 6 12337362 missense probably damaging 1.00
R3857:Thsd7a UTSW 6 12555226 missense probably benign 0.15
R3858:Thsd7a UTSW 6 12555226 missense probably benign 0.15
R3890:Thsd7a UTSW 6 12418337 missense probably benign 0.09
R3910:Thsd7a UTSW 6 12331549 missense probably damaging 0.96
R3933:Thsd7a UTSW 6 12555226 missense probably benign 0.15
R4369:Thsd7a UTSW 6 12468908 missense probably damaging 1.00
R4447:Thsd7a UTSW 6 12324635 missense probably damaging 0.98
R4664:Thsd7a UTSW 6 12337314 missense possibly damaging 0.79
R4664:Thsd7a UTSW 6 12504013 missense possibly damaging 0.90
R4665:Thsd7a UTSW 6 12337314 missense possibly damaging 0.79
R4665:Thsd7a UTSW 6 12504013 missense possibly damaging 0.90
R4666:Thsd7a UTSW 6 12337314 missense possibly damaging 0.79
R4666:Thsd7a UTSW 6 12504013 missense possibly damaging 0.90
R4668:Thsd7a UTSW 6 12408968 missense probably damaging 0.98
R4886:Thsd7a UTSW 6 12327660 nonsense probably null
R4918:Thsd7a UTSW 6 12327559 missense probably damaging 1.00
R4938:Thsd7a UTSW 6 12330992 missense probably benign 0.09
R5064:Thsd7a UTSW 6 12330952 missense possibly damaging 0.66
R5153:Thsd7a UTSW 6 12338655 missense probably benign 0.00
R5177:Thsd7a UTSW 6 12379583 nonsense probably null
R5242:Thsd7a UTSW 6 12327583 missense probably damaging 1.00
R5267:Thsd7a UTSW 6 12379602 missense probably damaging 1.00
R5442:Thsd7a UTSW 6 12748800 missense probably benign 0.00
R5506:Thsd7a UTSW 6 12332017 missense possibly damaging 0.85
R5525:Thsd7a UTSW 6 12332007 missense possibly damaging 0.52
R5544:Thsd7a UTSW 6 12379471 missense possibly damaging 0.94
R5651:Thsd7a UTSW 6 12343213 missense probably damaging 1.00
R5716:Thsd7a UTSW 6 12343148 missense probably benign 0.00
R5848:Thsd7a UTSW 6 12503923 missense probably damaging 1.00
R5958:Thsd7a UTSW 6 12337262 missense probably benign 0.02
R6012:Thsd7a UTSW 6 12379389 splice site probably null
R6139:Thsd7a UTSW 6 12379573 missense possibly damaging 0.93
R6243:Thsd7a UTSW 6 12327602 missense probably damaging 1.00
R6257:Thsd7a UTSW 6 12408988 nonsense probably null
R6273:Thsd7a UTSW 6 12408836 missense probably damaging 0.99
R6300:Thsd7a UTSW 6 12471104 nonsense probably null
R6314:Thsd7a UTSW 6 12554997 missense possibly damaging 0.87
R6392:Thsd7a UTSW 6 12468929 missense probably damaging 0.99
R6418:Thsd7a UTSW 6 12555082 nonsense probably null
R6515:Thsd7a UTSW 6 12501086 missense possibly damaging 0.47
R6725:Thsd7a UTSW 6 12555631 missense possibly damaging 0.87
R6742:Thsd7a UTSW 6 12408816 missense probably damaging 1.00
R6776:Thsd7a UTSW 6 12555637 missense possibly damaging 0.53
R6838:Thsd7a UTSW 6 12504075 missense probably damaging 0.99
R7104:Thsd7a UTSW 6 12379430 missense
R7170:Thsd7a UTSW 6 12352091 missense
R7349:Thsd7a UTSW 6 12352068 missense
R7460:Thsd7a UTSW 6 12554934 missense
R7467:Thsd7a UTSW 6 12331585 missense
Predicted Primers PCR Primer
(F):5'- TAGCACGCCATCGCTTGGTAAC -3'
(R):5'- ACCCCTGAGTCAGGACAAACATGAG -3'

Sequencing Primer
(F):5'- ATCGCTTGGTAACGGTATCC -3'
(R):5'- TTTACTGTGCAAGGCACAAAGC -3'
Posted On2013-06-12