Incidental Mutation 'R6021:Grm2'
ID478950
Institutional Source Beutler Lab
Gene Symbol Grm2
Ensembl Gene ENSMUSG00000023192
Gene Nameglutamate receptor, metabotropic 2
Synonyms4930441L02Rik, mGluR2, Gprc1b
MMRRC Submission 044194-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.579) question?
Stock #R6021 (G1)
Quality Score220.009
Status Validated
Chromosome9
Chromosomal Location106643095-106656082 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106650800 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 295 (D295G)
Ref Sequence ENSEMBL: ENSMUSP00000023959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023959] [ENSMUST00000201681]
Predicted Effect probably damaging
Transcript: ENSMUST00000023959
AA Change: D295G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023959
Gene: ENSMUSG00000023192
AA Change: D295G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 60 460 1.3e-96 PFAM
Pfam:NCD3G 496 546 3.7e-13 PFAM
Pfam:7tm_3 579 816 4.3e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200826
Predicted Effect possibly damaging
Transcript: ENSMUST00000201681
AA Change: D295G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144631
Gene: ENSMUSG00000023192
AA Change: D295G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 60 460 4.1e-95 PFAM
Pfam:7tm_3 458 538 4.6e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201955
Meta Mutation Damage Score 0.9351 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 94% (61/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous for disruptions in this gene display subtile behavioral modifications and moderate abnormalities in long term depression and EPSP in the hippocampus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,061,082 T338A probably damaging Het
4933427I04Rik A G 4: 123,860,716 D141G possibly damaging Het
A1bg T C 15: 60,919,864 E241G possibly damaging Het
Abca13 G A 11: 9,290,465 W776* probably null Het
Akr1b10 T A 6: 34,392,374 probably null Het
Atf7 T C 15: 102,557,473 D84G probably benign Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Azi2 T A 9: 118,047,419 M1K probably null Het
Boc T A 16: 44,488,654 M832L probably benign Het
Brix1 C T 15: 10,476,589 R267H probably benign Het
Cacna1s T C 1: 136,106,487 L1050P probably benign Het
Celsr2 G T 3: 108,401,245 P1789T probably benign Het
Crebbp G A 16: 4,085,418 R1986C probably damaging Het
Crtam T A 9: 40,990,181 I150F probably damaging Het
Crybg1 G T 10: 43,997,538 S1191R probably damaging Het
D630045J12Rik T C 6: 38,190,617 T1017A probably benign Het
Dnah10 A G 5: 124,736,984 E396G probably damaging Het
Enpp5 A T 17: 44,085,319 Y374F probably benign Het
Fzd4 G A 7: 89,407,734 A330T probably benign Het
Gabra5 A G 7: 57,507,992 S25P probably benign Het
Ggps1 T C 13: 14,054,004 Y198C probably damaging Het
Gm13101 A T 4: 143,965,766 C222S probably benign Het
Gm13762 G T 2: 88,973,032 Y286* probably null Het
Gm3173 A C 14: 4,514,873 D39A probably damaging Het
Gm4869 A T 5: 140,469,679 M347L probably damaging Het
H2-Bl T G 17: 36,081,274 E182A probably damaging Het
Igfbp5 A G 1: 72,863,204 M208T possibly damaging Het
Ildr2 T A 1: 166,303,604 M343K possibly damaging Het
Loxhd1 A T 18: 77,412,250 D120V probably damaging Het
Lrp1 T C 10: 127,578,014 D1175G probably damaging Het
Lrp1b C A 2: 41,344,427 D1171Y probably benign Het
Lrrc9 A T 12: 72,469,231 I563F probably damaging Het
Ltbp3 A T 19: 5,753,680 T798S probably benign Het
Msantd4 T A 9: 4,384,063 V128E probably benign Het
Mtf2 A G 5: 108,081,137 I69V possibly damaging Het
Myh10 T A 11: 68,808,862 S1712T possibly damaging Het
Mylk3 A G 8: 85,364,813 V121A possibly damaging Het
Ndufaf4 A G 4: 24,901,760 N100D probably benign Het
Notch2 T C 3: 98,121,972 F1017S probably damaging Het
Olfr1197 G T 2: 88,728,950 Y216* probably null Het
Olfr1253 A C 2: 89,752,121 S236A probably benign Het
P2ry2 T C 7: 100,998,400 T233A probably benign Het
Paip1 T "TTA,TT" 13: 119,457,135 probably null Het
Pak1 T C 7: 97,854,463 S2P probably damaging Het
Pde8b A T 13: 95,026,162 D817E possibly damaging Het
Pfdn2 C A 1: 171,345,770 probably benign Het
Raver1 A G 9: 21,076,622 L606P probably damaging Het
Robo3 C T 9: 37,422,533 W668* probably null Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Rxfp2 A G 5: 150,063,737 N337S possibly damaging Het
Samhd1 T C 2: 157,120,554 probably null Het
Sardh A G 2: 27,189,643 V879A probably benign Het
Slc4a4 A T 5: 89,040,402 probably benign Het
Slc6a11 T C 6: 114,230,051 L332P probably damaging Het
Tas2r135 T C 6: 42,406,387 Y287H probably damaging Het
Tlr4 T A 4: 66,840,866 I632N probably damaging Het
Tmem145 C T 7: 25,308,845 probably null Het
Trmt61a C A 12: 111,680,977 F169L probably damaging Het
Trp53tg5 T A 2: 164,471,471 I95L probably benign Het
Vmn1r85 T C 7: 13,084,689 E176G probably benign Het
Vmn2r75 T C 7: 86,171,612 D38G probably benign Het
Vmn2r99 A G 17: 19,377,948 Y78C probably damaging Het
Wrb T C 16: 96,145,678 probably benign Het
Zfp964 G T 8: 69,663,092 S114I unknown Het
Other mutations in Grm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1053:Grm2 UTSW 9 106648157 missense probably damaging 0.98
R1116:Grm2 UTSW 9 106647927 missense probably damaging 0.97
R1593:Grm2 UTSW 9 106650914 missense probably damaging 1.00
R1619:Grm2 UTSW 9 106647471 missense probably damaging 1.00
R2174:Grm2 UTSW 9 106647795 missense probably benign 0.05
R2357:Grm2 UTSW 9 106647581 missense probably damaging 0.99
R3115:Grm2 UTSW 9 106647623 missense probably damaging 0.97
R4453:Grm2 UTSW 9 106653879 missense probably damaging 0.97
R4700:Grm2 UTSW 9 106653931 missense probably benign 0.18
R4854:Grm2 UTSW 9 106654132 missense possibly damaging 0.80
R4871:Grm2 UTSW 9 106647645 missense probably benign 0.00
R4888:Grm2 UTSW 9 106650666 missense probably damaging 0.98
R4999:Grm2 UTSW 9 106653990 missense probably damaging 1.00
R5617:Grm2 UTSW 9 106651076 unclassified probably null
R5620:Grm2 UTSW 9 106650446 missense probably damaging 0.96
R6089:Grm2 UTSW 9 106653891 missense probably damaging 1.00
R6662:Grm2 UTSW 9 106648053 missense probably benign 0.01
R7061:Grm2 UTSW 9 106651225 missense probably damaging 0.98
R7266:Grm2 UTSW 9 106647171 missense
R7270:Grm2 UTSW 9 106651058 missense probably damaging 0.98
R7479:Grm2 UTSW 9 106653851 missense possibly damaging 0.84
R7542:Grm2 UTSW 9 106651169 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTTGACTCCTGTTCAAAGGGTAC -3'
(R):5'- AACATCTGCGTGGCCACTTC -3'

Sequencing Primer
(F):5'- GGAAGCTGCAACGGAACCTC -3'
(R):5'- TCGGAGAAGGTGGGCCG -3'
Posted On2017-06-26