Mutagenetix > Incidental Mutation

Incidental Mutation 'R6021:Lrrc9'

478956

Institutional Source

Beutler Lab

Gene Symbol

Lrrc9

Ensembl Gene

ENSMUSG00000021090

Gene Name

leucine rich repeat containing 9

Synonyms

4930432K16Rik, 4921529O18Rik

MMRRC Submission

044194-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.184) question?

Stock #

R6021 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

72441866-72530750 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 72469231 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 563 (I563F)

Ref Sequence

ENSEMBL: ENSMUSP00000124602 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000161284] [ENSMUST00000162159] [ENSMUST00000221360]

AlphaFold

Q8CDN9

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161195

Predicted Effect

probably damaging
Transcript: ENSMUST00000161284
AA Change: I563F

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000124602
Gene: ENSMUSG00000021090
AA Change: I563F

Domain	Start	End	E-Value	Type
Pfam:LRR_4	77	118	2.8e-11	PFAM
LRR	119	140	8.49e1	SMART
LRR	141	164	2.27e1	SMART
LRR	165	187	2.09e2	SMART
LRRcap	210	228	6.12e1	SMART
low complexity region	373	384	N/A	INTRINSIC
low complexity region	424	436	N/A	INTRINSIC
LRR	706	727	1.41e2	SMART
LRR	728	749	6.78e1	SMART
LRR	750	773	7.17e1	SMART
LRRcap	793	811	2.26e2	SMART
LRR	943	966	2.67e-1	SMART
LRR	967	992	1.22e1	SMART
LRRcap	1031	1049	4.37e0	SMART
low complexity region	1109	1120	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161957

Predicted Effect

probably damaging
Transcript: ENSMUST00000162159
AA Change: I562F

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000124394
Gene: ENSMUSG00000021090
AA Change: I562F

Domain	Start	End	E-Value	Type
LRR	53	74	5.39e2	SMART
LRR	75	96	1.14e2	SMART
LRR	97	118	7.9e-4	SMART
LRR	119	140	2.75e-3	SMART
LRR	141	164	2.27e1	SMART
LRR	164	185	1.87e1	SMART
LRRcap	210	228	6.12e1	SMART
low complexity region	373	384	N/A	INTRINSIC
low complexity region	424	436	N/A	INTRINSIC
LRR	705	726	1.41e2	SMART
LRR	727	748	6.78e1	SMART
LRR	749	771	1.37e1	SMART
LRRcap	792	810	2.26e2	SMART
LRR	898	919	2.62e1	SMART
LRR	920	941	5.17e1	SMART
LRR	942	965	2.67e-1	SMART
LRR	966	991	1.22e1	SMART
LRR	1013	1032	4.42e2	SMART
LRRcap	1030	1048	4.37e0	SMART
low complexity region	1108	1119	N/A	INTRINSIC
LRR	1128	1150	2.4e1	SMART
LRR	1191	1209	5.7e2	SMART
LRR	1215	1236	1.03e-2	SMART
LRR	1237	1260	8.48e0	SMART
LRR	1283	1304	2.67e-1	SMART
Blast:LRR	1308	1333	4e-6	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162179

Predicted Effect

possibly damaging
Transcript: ENSMUST00000221360
AA Change: I563F

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)

Meta Mutation Damage Score

0.2485

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.2%

Validation Efficiency

94% (61/65)

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	A	G	13: 63,061,082	T338A	probably damaging	Het
4933427I04Rik	A	G	4: 123,860,716	D141G	possibly damaging	Het
A1bg	T	C	15: 60,919,864	E241G	possibly damaging	Het
Abca13	G	A	11: 9,290,465	W776*	probably null	Het
Akr1b10	T	A	6: 34,392,374		probably null	Het
Atf7	T	C	15: 102,557,473	D84G	probably benign	Het
AW209491	C	T	13: 14,637,780	A406V	probably benign	Het
Azi2	T	A	9: 118,047,419	M1K	probably null	Het
Boc	T	A	16: 44,488,654	M832L	probably benign	Het
Brix1	C	T	15: 10,476,589	R267H	probably benign	Het
Cacna1s	T	C	1: 136,106,487	L1050P	probably benign	Het
Celsr2	G	T	3: 108,401,245	P1789T	probably benign	Het
Crebbp	G	A	16: 4,085,418	R1986C	probably damaging	Het
Crtam	T	A	9: 40,990,181	I150F	probably damaging	Het
Crybg1	G	T	10: 43,997,538	S1191R	probably damaging	Het
D630045J12Rik	T	C	6: 38,190,617	T1017A	probably benign	Het
Dnah10	A	G	5: 124,736,984	E396G	probably damaging	Het
Enpp5	A	T	17: 44,085,319	Y374F	probably benign	Het
Fzd4	G	A	7: 89,407,734	A330T	probably benign	Het
Gabra5	A	G	7: 57,507,992	S25P	probably benign	Het
Ggps1	T	C	13: 14,054,004	Y198C	probably damaging	Het
Gm13101	A	T	4: 143,965,766	C222S	probably benign	Het
Gm13762	G	T	2: 88,973,032	Y286*	probably null	Het
Gm3173	A	C	14: 4,514,873	D39A	probably damaging	Het
Gm4869	A	T	5: 140,469,679	M347L	probably damaging	Het
Grm2	T	C	9: 106,650,800	D295G	probably damaging	Het
H2-Bl	T	G	17: 36,081,274	E182A	probably damaging	Het
Igfbp5	A	G	1: 72,863,204	M208T	possibly damaging	Het
Ildr2	T	A	1: 166,303,604	M343K	possibly damaging	Het
Loxhd1	A	T	18: 77,412,250	D120V	probably damaging	Het
Lrp1	T	C	10: 127,578,014	D1175G	probably damaging	Het
Lrp1b	C	A	2: 41,344,427	D1171Y	probably benign	Het
Ltbp3	A	T	19: 5,753,680	T798S	probably benign	Het
Msantd4	T	A	9: 4,384,063	V128E	probably benign	Het
Mtf2	A	G	5: 108,081,137	I69V	possibly damaging	Het
Myh10	T	A	11: 68,808,862	S1712T	possibly damaging	Het
Mylk3	A	G	8: 85,364,813	V121A	possibly damaging	Het
Ndufaf4	A	G	4: 24,901,760	N100D	probably benign	Het
Notch2	T	C	3: 98,121,972	F1017S	probably damaging	Het
Olfr1197	G	T	2: 88,728,950	Y216*	probably null	Het
Olfr1253	A	C	2: 89,752,121	S236A	probably benign	Het
P2ry2	T	C	7: 100,998,400	T233A	probably benign	Het
Paip1	T	"TTA,TT"	13: 119,457,135		probably null	Het
Pak1	T	C	7: 97,854,463	S2P	probably damaging	Het
Pde8b	A	T	13: 95,026,162	D817E	possibly damaging	Het
Pfdn2	C	A	1: 171,345,770		probably benign	Het
Raver1	A	G	9: 21,076,622	L606P	probably damaging	Het
Robo3	C	T	9: 37,422,533	W668*	probably null	Het
Rsf1	G	GACGGCGGCT	7: 97,579,909		probably benign	Het
Rxfp2	A	G	5: 150,063,737	N337S	possibly damaging	Het
Samhd1	T	C	2: 157,120,554		probably null	Het
Sardh	A	G	2: 27,189,643	V879A	probably benign	Het
Slc4a4	A	T	5: 89,040,402		probably benign	Het
Slc6a11	T	C	6: 114,230,051	L332P	probably damaging	Het
Tas2r135	T	C	6: 42,406,387	Y287H	probably damaging	Het
Tlr4	T	A	4: 66,840,866	I632N	probably damaging	Het
Tmem145	C	T	7: 25,308,845		probably null	Het
Trmt61a	C	A	12: 111,680,977	F169L	probably damaging	Het
Trp53tg5	T	A	2: 164,471,471	I95L	probably benign	Het
Vmn1r85	T	C	7: 13,084,689	E176G	probably benign	Het
Vmn2r75	T	C	7: 86,171,612	D38G	probably benign	Het
Vmn2r99	A	G	17: 19,377,948	Y78C	probably damaging	Het
Wrb	T	C	16: 96,145,678		probably benign	Het
Zfp964	G	T	8: 69,663,092	S114I	unknown	Het

Other mutations in Lrrc9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Lrrc9	APN	12	72486243	missense	possibly damaging	0.63
IGL00843:Lrrc9	APN	12	72463417	missense	possibly damaging	0.78
IGL01923:Lrrc9	APN	12	72510412	missense	possibly damaging	0.93
IGL02027:Lrrc9	APN	12	72470334	splice site	probably benign
IGL02271:Lrrc9	APN	12	72510381	missense	probably benign	0.06
IGL02398:Lrrc9	APN	12	72466903	missense	probably benign
IGL02795:Lrrc9	APN	12	72478768	missense	probably damaging	1.00
IGL02931:Lrrc9	APN	12	72454149	missense	probably damaging	1.00
IGL03257:Lrrc9	APN	12	72449768	missense	probably benign
BB006:Lrrc9	UTSW	12	72486297	missense	possibly damaging	0.92
BB016:Lrrc9	UTSW	12	72486297	missense	possibly damaging	0.92
IGL02799:Lrrc9	UTSW	12	72506404	missense	probably damaging	1.00
R0172:Lrrc9	UTSW	12	72463486	missense	possibly damaging	0.50
R0315:Lrrc9	UTSW	12	72456028	missense	probably damaging	0.96
R0492:Lrrc9	UTSW	12	72478763	missense	possibly damaging	0.47
R0617:Lrrc9	UTSW	12	72483014	missense	probably damaging	1.00
R0639:Lrrc9	UTSW	12	72486288	missense	probably damaging	1.00
R0987:Lrrc9	UTSW	12	72510382	missense	probably benign	0.00
R1325:Lrrc9	UTSW	12	72497104	missense	probably damaging	0.99
R1465:Lrrc9	UTSW	12	72500759	missense	probably benign	0.05
R1465:Lrrc9	UTSW	12	72500759	missense	probably benign	0.05
R1479:Lrrc9	UTSW	12	72460825	nonsense	probably null
R1564:Lrrc9	UTSW	12	72487053	missense	probably damaging	1.00
R1626:Lrrc9	UTSW	12	72495661	splice site	probably null
R1632:Lrrc9	UTSW	12	72460020	splice site	probably null
R1715:Lrrc9	UTSW	12	72477299	missense	probably damaging	1.00
R1743:Lrrc9	UTSW	12	72456117	missense	probably damaging	1.00
R1779:Lrrc9	UTSW	12	72455998	nonsense	probably null
R1866:Lrrc9	UTSW	12	72497138	missense	probably damaging	0.97
R1878:Lrrc9	UTSW	12	72476164	critical splice donor site	probably null
R1990:Lrrc9	UTSW	12	72497861	missense	probably damaging	0.99
R2361:Lrrc9	UTSW	12	72463470	missense	possibly damaging	0.52
R3752:Lrrc9	UTSW	12	72460806	nonsense	probably null
R3833:Lrrc9	UTSW	12	72482991	missense	probably damaging	1.00
R4134:Lrrc9	UTSW	12	72466966	missense	probably benign	0.00
R4651:Lrrc9	UTSW	12	72477386	missense	probably damaging	1.00
R4652:Lrrc9	UTSW	12	72477386	missense	probably damaging	1.00
R4659:Lrrc9	UTSW	12	72470264	missense	probably damaging	1.00
R4831:Lrrc9	UTSW	12	72499679	missense	probably damaging	1.00
R4857:Lrrc9	UTSW	12	72499692	missense	possibly damaging	0.94
R5017:Lrrc9	UTSW	12	72506325	missense	possibly damaging	0.86
R5163:Lrrc9	UTSW	12	72449389	missense	probably damaging	1.00
R5279:Lrrc9	UTSW	12	72495594	missense	possibly damaging	0.80
R5434:Lrrc9	UTSW	12	72454088	missense	probably damaging	0.98
R5783:Lrrc9	UTSW	12	72456053	missense	possibly damaging	0.62
R6214:Lrrc9	UTSW	12	72459853	missense	probably damaging	1.00
R6255:Lrrc9	UTSW	12	72487023	missense	probably benign	0.33
R6538:Lrrc9	UTSW	12	72500929	missense	probably benign	0.08
R6563:Lrrc9	UTSW	12	72486395	splice site	probably null
R6672:Lrrc9	UTSW	12	72473936	missense	possibly damaging	0.88
R6919:Lrrc9	UTSW	12	72506393	missense	probably benign	0.01
R6929:Lrrc9	UTSW	12	72450772	missense	probably benign	0.41
R7092:Lrrc9	UTSW	12	72463464	missense	possibly damaging	0.81
R7150:Lrrc9	UTSW	12	72466952	missense	probably benign	0.00
R7338:Lrrc9	UTSW	12	72463531	splice site	probably null
R7398:Lrrc9	UTSW	12	72500816	missense	probably damaging	0.98
R7477:Lrrc9	UTSW	12	72503527	critical splice donor site	probably null
R7501:Lrrc9	UTSW	12	72449716	missense	probably damaging	1.00
R7542:Lrrc9	UTSW	12	72506320	missense	probably damaging	0.96
R7816:Lrrc9	UTSW	12	72495692	missense	probably damaging	1.00
R7870:Lrrc9	UTSW	12	72486190	missense	probably damaging	0.99
R7929:Lrrc9	UTSW	12	72486297	missense	possibly damaging	0.92
R8042:Lrrc9	UTSW	12	72460906	missense	probably benign	0.02
R8108:Lrrc9	UTSW	12	72454059	missense	probably damaging	1.00
R8192:Lrrc9	UTSW	12	72449389	missense	probably damaging	1.00
R8244:Lrrc9	UTSW	12	72499610	missense	probably benign	0.22
R8333:Lrrc9	UTSW	12	72481543	missense	probably benign	0.38
R9288:Lrrc9	UTSW	12	72476084	missense	probably benign	0.01
R9324:Lrrc9	UTSW	12	72449397	missense	probably damaging	1.00
R9342:Lrrc9	UTSW	12	72459993	missense	probably damaging	1.00
R9557:Lrrc9	UTSW	12	72486207	missense	probably benign	0.01
R9624:Lrrc9	UTSW	12	72450812	missense	probably benign	0.19
R9677:Lrrc9	UTSW	12	72450765	missense	probably damaging	1.00
X0025:Lrrc9	UTSW	12	72497060	missense	probably damaging	1.00
Z1176:Lrrc9	UTSW	12	72477393	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAGAGGCATTGCTAAATTATTGTG -3'
(R):5'- GCCTTGTTAGGTTCAGATTAGACCATG -3'

Sequencing Primer
(F):5'- CATTCTATAGCCCAGTGATGTGCAG -3'
(R):5'- GGTTCAGATTAGACCATGCTATAAG -3'

Posted On

2017-06-26