Incidental Mutation 'R6021:Paip1'
ID478962
Institutional Source Beutler Lab
Gene Symbol Paip1
Ensembl Gene ENSMUSG00000025451
Gene Namepolyadenylate binding protein-interacting protein 1
Synonyms
MMRRC Submission 044194-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.295) question?
Stock #R6021 (G1)
Quality Score118.588
Status Not validated
Chromosome13
Chromosomal Location119428601-119458218 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) T to "TTA,TT" at 119457135 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026520] [ENSMUST00000109203] [ENSMUST00000126957] [ENSMUST00000173627] [ENSMUST00000174533]
Predicted Effect probably benign
Transcript: ENSMUST00000026520
SMART Domains Protein: ENSMUSP00000026520
Gene: ENSMUSG00000025451

DomainStartEndE-ValueType
Pfam:PAM2 44 61 8.9e-8 PFAM
MIF4G 80 297 2.62e-46 SMART
low complexity region 373 385 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109203
SMART Domains Protein: ENSMUSP00000104826
Gene: ENSMUSG00000025451

DomainStartEndE-ValueType
Pfam:PAM2 11 28 3.7e-7 PFAM
MIF4G 47 264 2.62e-46 SMART
low complexity region 340 352 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126957
SMART Domains Protein: ENSMUSP00000117256
Gene: ENSMUSG00000025451

DomainStartEndE-ValueType
low complexity region 7 38 N/A INTRINSIC
low complexity region 44 74 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
Pfam:PAM2 128 145 3.3e-7 PFAM
MIF4G 164 381 2.62e-46 SMART
low complexity region 457 469 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132304
SMART Domains Protein: ENSMUSP00000134617
Gene: ENSMUSG00000025451

DomainStartEndE-ValueType
low complexity region 7 38 N/A INTRINSIC
low complexity region 44 74 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
Pfam:PAM2 128 145 6.8e-5 PFAM
Pfam:MIF4G 164 267 1.9e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000173627
SMART Domains Protein: ENSMUSP00000134051
Gene: ENSMUSG00000025451

DomainStartEndE-ValueType
Pfam:PAM2 44 61 3.6e-7 PFAM
MIF4G 80 297 2.62e-46 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174533
SMART Domains Protein: ENSMUSP00000134365
Gene: ENSMUSG00000025451

DomainStartEndE-ValueType
Pfam:MIF4G 49 106 1.4e-8 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 94% (61/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with poly(A)-binding protein and with the cap-binding complex eIF4A. It is involved in translational initiation and protein biosynthesis. Overexpression of this gene in COS7 cells stimulates translation. Alternative splicing occurs at this locus and three transcript variants encoding three distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,061,082 T338A probably damaging Het
4933427I04Rik A G 4: 123,860,716 D141G possibly damaging Het
A1bg T C 15: 60,919,864 E241G possibly damaging Het
Abca13 G A 11: 9,290,465 W776* probably null Het
Akr1b10 T A 6: 34,392,374 probably null Het
Atf7 T C 15: 102,557,473 D84G probably benign Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Azi2 T A 9: 118,047,419 M1K probably null Het
Boc T A 16: 44,488,654 M832L probably benign Het
Brix1 C T 15: 10,476,589 R267H probably benign Het
Cacna1s T C 1: 136,106,487 L1050P probably benign Het
Celsr2 G T 3: 108,401,245 P1789T probably benign Het
Crebbp G A 16: 4,085,418 R1986C probably damaging Het
Crtam T A 9: 40,990,181 I150F probably damaging Het
Crybg1 G T 10: 43,997,538 S1191R probably damaging Het
D630045J12Rik T C 6: 38,190,617 T1017A probably benign Het
Dnah10 A G 5: 124,736,984 E396G probably damaging Het
Enpp5 A T 17: 44,085,319 Y374F probably benign Het
Fzd4 G A 7: 89,407,734 A330T probably benign Het
Gabra5 A G 7: 57,507,992 S25P probably benign Het
Ggps1 T C 13: 14,054,004 Y198C probably damaging Het
Gm13101 A T 4: 143,965,766 C222S probably benign Het
Gm13762 G T 2: 88,973,032 Y286* probably null Het
Gm3173 A C 14: 4,514,873 D39A probably damaging Het
Gm4869 A T 5: 140,469,679 M347L probably damaging Het
Grm2 T C 9: 106,650,800 D295G probably damaging Het
H2-Bl T G 17: 36,081,274 E182A probably damaging Het
Igfbp5 A G 1: 72,863,204 M208T possibly damaging Het
Ildr2 T A 1: 166,303,604 M343K possibly damaging Het
Loxhd1 A T 18: 77,412,250 D120V probably damaging Het
Lrp1 T C 10: 127,578,014 D1175G probably damaging Het
Lrp1b C A 2: 41,344,427 D1171Y probably benign Het
Lrrc9 A T 12: 72,469,231 I563F probably damaging Het
Ltbp3 A T 19: 5,753,680 T798S probably benign Het
Msantd4 T A 9: 4,384,063 V128E probably benign Het
Mtf2 A G 5: 108,081,137 I69V possibly damaging Het
Myh10 T A 11: 68,808,862 S1712T possibly damaging Het
Mylk3 A G 8: 85,364,813 V121A possibly damaging Het
Ndufaf4 A G 4: 24,901,760 N100D probably benign Het
Notch2 T C 3: 98,121,972 F1017S probably damaging Het
Olfr1197 G T 2: 88,728,950 Y216* probably null Het
Olfr1253 A C 2: 89,752,121 S236A probably benign Het
P2ry2 T C 7: 100,998,400 T233A probably benign Het
Pak1 T C 7: 97,854,463 S2P probably damaging Het
Pde8b A T 13: 95,026,162 D817E possibly damaging Het
Pfdn2 C A 1: 171,345,770 probably benign Het
Raver1 A G 9: 21,076,622 L606P probably damaging Het
Robo3 C T 9: 37,422,533 W668* probably null Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Rxfp2 A G 5: 150,063,737 N337S possibly damaging Het
Samhd1 T C 2: 157,120,554 probably null Het
Sardh A G 2: 27,189,643 V879A probably benign Het
Slc4a4 A T 5: 89,040,402 probably benign Het
Slc6a11 T C 6: 114,230,051 L332P probably damaging Het
Tas2r135 T C 6: 42,406,387 Y287H probably damaging Het
Tlr4 T A 4: 66,840,866 I632N probably damaging Het
Tmem145 C T 7: 25,308,845 probably null Het
Trmt61a C A 12: 111,680,977 F169L probably damaging Het
Trp53tg5 T A 2: 164,471,471 I95L probably benign Het
Vmn1r85 T C 7: 13,084,689 E176G probably benign Het
Vmn2r75 T C 7: 86,171,612 D38G probably benign Het
Vmn2r99 A G 17: 19,377,948 Y78C probably damaging Het
Wrb T C 16: 96,145,678 probably benign Het
Zfp964 G T 8: 69,663,092 S114I unknown Het
Other mutations in Paip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02668:Paip1 APN 13 119438071 missense probably damaging 1.00
IGL02873:Paip1 APN 13 119445812 missense possibly damaging 0.95
R0517:Paip1 UTSW 13 119447790 missense probably damaging 1.00
R0791:Paip1 UTSW 13 119430318 missense possibly damaging 0.69
R0792:Paip1 UTSW 13 119430318 missense possibly damaging 0.69
R1419:Paip1 UTSW 13 119457017 missense probably damaging 0.99
R1572:Paip1 UTSW 13 119451784 unclassified probably benign
R1935:Paip1 UTSW 13 119457014 missense probably damaging 1.00
R1936:Paip1 UTSW 13 119457014 missense probably damaging 1.00
R2072:Paip1 UTSW 13 119430262 missense possibly damaging 0.88
R3827:Paip1 UTSW 13 119430232 start codon destroyed probably null 0.47
R4082:Paip1 UTSW 13 119457004 missense probably damaging 1.00
R4092:Paip1 UTSW 13 119449913 missense probably benign 0.02
R4854:Paip1 UTSW 13 119449889 splice site probably benign
R5012:Paip1 UTSW 13 119447802 missense probably benign
R5103:Paip1 UTSW 13 119437979 missense possibly damaging 0.95
R5425:Paip1 UTSW 13 119430166 missense possibly damaging 0.60
R5592:Paip1 UTSW 13 119450798 missense probably damaging 1.00
R5851:Paip1 UTSW 13 119440765 missense possibly damaging 0.94
R5929:Paip1 UTSW 13 119445790 missense probably damaging 1.00
R5976:Paip1 UTSW 13 119456997 missense probably damaging 1.00
R6326:Paip1 UTSW 13 119430217 missense probably benign 0.00
R6964:Paip1 UTSW 13 119450770 missense possibly damaging 0.61
R7544:Paip1 UTSW 13 119445801 missense probably damaging 1.00
R7552:Paip1 UTSW 13 119440820 missense possibly damaging 0.83
R7659:Paip1 UTSW 13 119450770 missense possibly damaging 0.61
R7660:Paip1 UTSW 13 119450770 missense possibly damaging 0.61
R7661:Paip1 UTSW 13 119450770 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- AGGAGAGTGCATTTAACATCTCCAG -3'
(R):5'- GCAGCCAAAACAGTAGAATTAACTG -3'

Sequencing Primer
(F):5'- TTTTGGATTTGAAAAGCAGCAAGG -3'
(R):5'- TTGGCAGGTAGTGTTAAAC -3'
Posted On2017-06-26