Mutagenetix > Incidental Mutations

Incidental Mutation 'R6021:Ltbp3'

478974

Institutional Source

Beutler Lab

Gene Symbol

Ltbp3

Ensembl Gene

ENSMUSG00000024940

Gene Name

latent transforming growth factor beta binding protein 3

Synonyms

Ltbp2

MMRRC Submission

044194-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.269) question?

Stock #

R6021 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

5740904-5758532 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 5753680 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 798 (T798S)

Ref Sequence

ENSEMBL: ENSMUSP00000080214 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025890] [ENSMUST00000081496]

Predicted Effect

probably benign
Transcript: ENSMUST00000025890

SMART Domains

Protein: ENSMUSP00000025890
Gene: ENSMUSG00000024941

Domain	Start	End	E-Value	Type
low complexity region	18	28	N/A	INTRINSIC
Pfam:Pkinase_Tyr	30	254	3.3e-11	PFAM
Pfam:Pkinase	31	252	2e-14	PFAM
SCOP:d1gw5a_	350	536	1e-18	SMART
low complexity region	556	577	N/A	INTRINSIC
low complexity region	608	620	N/A	INTRINSIC
coiled coil region	759	795	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000081496
AA Change: T798S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000080214
Gene: ENSMUSG00000024940
AA Change: T798S

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
EGF	109	138	6.76e-3	SMART
low complexity region	140	154	N/A	INTRINSIC
low complexity region	191	199	N/A	INTRINSIC
low complexity region	221	233	N/A	INTRINSIC
low complexity region	254	273	N/A	INTRINSIC
Pfam:TB	286	323	8e-9	PFAM
EGF_CA	352	392	2.08e-12	SMART
Pfam:TB	411	451	4.8e-18	PFAM
low complexity region	526	537	N/A	INTRINSIC
EGF_CA	571	612	8.71e-6	SMART
EGF_CA	613	656	2.8e-9	SMART
EGF_CA	657	699	2.48e-10	SMART
EGF_CA	700	740	4.96e-10	SMART
EGF_CA	741	781	1.69e-12	SMART
EGF_CA	782	822	1.94e-12	SMART
EGF_CA	823	862	3.27e-10	SMART
EGF_CA	863	905	3.32e-11	SMART
Pfam:TB	925	967	5.7e-16	PFAM
EGF_CA	990	1032	4.49e-8	SMART
EGF_CA	1033	1073	3.17e-8	SMART
Pfam:TB	1097	1134	1.2e-11	PFAM
EGF	1170	1203	1.53e1	SMART
EGF_CA	1204	1248	1.53e-10	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.2%

Validation Efficiency

94% (61/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a complex with transforming growth factor beta (TGF-beta) proteins and may be involved in their subcellular localization. Activation of this complex requires removal of the encoded binding protein. This protein also may play a structural role in the extracellular matrix. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit craniofacial malformations including an overshot mandible and ossification of synchondroses. Mutants develop osteosclerosis of long bones and osteoarthritis, and, in some cases, high corticosterone levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	A	G	13: 63,061,082	T338A	probably damaging	Het
4933427I04Rik	A	G	4: 123,860,716	D141G	possibly damaging	Het
A1bg	T	C	15: 60,919,864	E241G	possibly damaging	Het
Abca13	G	A	11: 9,290,465	W776*	probably null	Het
Akr1b10	T	A	6: 34,392,374		probably null	Het
Atf7	T	C	15: 102,557,473	D84G	probably benign	Het
AW209491	C	T	13: 14,637,780	A406V	probably benign	Het
Azi2	T	A	9: 118,047,419	M1K	probably null	Het
Boc	T	A	16: 44,488,654	M832L	probably benign	Het
Brix1	C	T	15: 10,476,589	R267H	probably benign	Het
Cacna1s	T	C	1: 136,106,487	L1050P	probably benign	Het
Celsr2	G	T	3: 108,401,245	P1789T	probably benign	Het
Crebbp	G	A	16: 4,085,418	R1986C	probably damaging	Het
Crtam	T	A	9: 40,990,181	I150F	probably damaging	Het
Crybg1	G	T	10: 43,997,538	S1191R	probably damaging	Het
D630045J12Rik	T	C	6: 38,190,617	T1017A	probably benign	Het
Dnah10	A	G	5: 124,736,984	E396G	probably damaging	Het
Enpp5	A	T	17: 44,085,319	Y374F	probably benign	Het
Fzd4	G	A	7: 89,407,734	A330T	probably benign	Het
Gabra5	A	G	7: 57,507,992	S25P	probably benign	Het
Ggps1	T	C	13: 14,054,004	Y198C	probably damaging	Het
Gm13101	A	T	4: 143,965,766	C222S	probably benign	Het
Gm13762	G	T	2: 88,973,032	Y286*	probably null	Het
Gm3173	A	C	14: 4,514,873	D39A	probably damaging	Het
Gm4869	A	T	5: 140,469,679	M347L	probably damaging	Het
Grm2	T	C	9: 106,650,800	D295G	probably damaging	Het
H2-Bl	T	G	17: 36,081,274	E182A	probably damaging	Het
Igfbp5	A	G	1: 72,863,204	M208T	possibly damaging	Het
Ildr2	T	A	1: 166,303,604	M343K	possibly damaging	Het
Loxhd1	A	T	18: 77,412,250	D120V	probably damaging	Het
Lrp1	T	C	10: 127,578,014	D1175G	probably damaging	Het
Lrp1b	C	A	2: 41,344,427	D1171Y	probably benign	Het
Lrrc9	A	T	12: 72,469,231	I563F	probably damaging	Het
Msantd4	T	A	9: 4,384,063	V128E	probably benign	Het
Mtf2	A	G	5: 108,081,137	I69V	possibly damaging	Het
Myh10	T	A	11: 68,808,862	S1712T	possibly damaging	Het
Mylk3	A	G	8: 85,364,813	V121A	possibly damaging	Het
Ndufaf4	A	G	4: 24,901,760	N100D	probably benign	Het
Notch2	T	C	3: 98,121,972	F1017S	probably damaging	Het
Olfr1197	G	T	2: 88,728,950	Y216*	probably null	Het
Olfr1253	A	C	2: 89,752,121	S236A	probably benign	Het
P2ry2	T	C	7: 100,998,400	T233A	probably benign	Het
Paip1	T	"TTA,TT"	13: 119,457,135		probably null	Het
Pak1	T	C	7: 97,854,463	S2P	probably damaging	Het
Pde8b	A	T	13: 95,026,162	D817E	possibly damaging	Het
Pfdn2	C	A	1: 171,345,770		probably benign	Het
Raver1	A	G	9: 21,076,622	L606P	probably damaging	Het
Robo3	C	T	9: 37,422,533	W668*	probably null	Het
Rsf1	G	GACGGCGGCT	7: 97,579,909		probably benign	Het
Rxfp2	A	G	5: 150,063,737	N337S	possibly damaging	Het
Samhd1	T	C	2: 157,120,554		probably null	Het
Sardh	A	G	2: 27,189,643	V879A	probably benign	Het
Slc4a4	A	T	5: 89,040,402		probably benign	Het
Slc6a11	T	C	6: 114,230,051	L332P	probably damaging	Het
Tas2r135	T	C	6: 42,406,387	Y287H	probably damaging	Het
Tlr4	T	A	4: 66,840,866	I632N	probably damaging	Het
Tmem145	C	T	7: 25,308,845		probably null	Het
Trmt61a	C	A	12: 111,680,977	F169L	probably damaging	Het
Trp53tg5	T	A	2: 164,471,471	I95L	probably benign	Het
Vmn1r85	T	C	7: 13,084,689	E176G	probably benign	Het
Vmn2r75	T	C	7: 86,171,612	D38G	probably benign	Het
Vmn2r99	A	G	17: 19,377,948	Y78C	probably damaging	Het
Wrb	T	C	16: 96,145,678		probably benign	Het
Zfp964	G	T	8: 69,663,092	S114I	unknown	Het

Other mutations in Ltbp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00507:Ltbp3	APN	19	5756016	missense	probably damaging	0.99
IGL00978:Ltbp3	APN	19	5754019	missense	probably benign	0.26
IGL01517:Ltbp3	APN	19	5757732	missense	possibly damaging	0.57
IGL01529:Ltbp3	APN	19	5747839	missense	probably benign	0.06
IGL03119:Ltbp3	APN	19	5757443	missense	probably damaging	0.98
csp	UTSW	19	5747688	missense	probably damaging	1.00
lilia	UTSW	19	5747857	critical splice donor site	probably null
Rapunzel	UTSW	19	5753942	nonsense	probably null
PIT4305001:Ltbp3	UTSW	19	5752067	missense	probably damaging	0.99
PIT4453001:Ltbp3	UTSW	19	5757794	missense	probably damaging	0.97
PIT4480001:Ltbp3	UTSW	19	5751226	missense	possibly damaging	0.73
R0211:Ltbp3	UTSW	19	5752143	critical splice donor site	probably null
R0718:Ltbp3	UTSW	19	5746748	splice site	probably benign
R1103:Ltbp3	UTSW	19	5747411	critical splice acceptor site	probably null
R1103:Ltbp3	UTSW	19	5747412	critical splice acceptor site	probably null
R1299:Ltbp3	UTSW	19	5745428	splice site	probably benign
R1510:Ltbp3	UTSW	19	5748887	missense	probably benign	0.02
R1616:Ltbp3	UTSW	19	5746967	missense	probably damaging	1.00
R1682:Ltbp3	UTSW	19	5751754	missense	probably benign	0.02
R1752:Ltbp3	UTSW	19	5745657	missense	probably benign	0.09
R1806:Ltbp3	UTSW	19	5753942	nonsense	probably null
R1866:Ltbp3	UTSW	19	5747849	missense	probably benign	0.43
R1981:Ltbp3	UTSW	19	5758079	missense	probably benign	0.15
R2211:Ltbp3	UTSW	19	5753962	missense	possibly damaging	0.79
R2239:Ltbp3	UTSW	19	5751523	nonsense	probably null
R2261:Ltbp3	UTSW	19	5754022	missense	probably benign	0.02
R2263:Ltbp3	UTSW	19	5754022	missense	probably benign	0.02
R2380:Ltbp3	UTSW	19	5751523	nonsense	probably null
R2412:Ltbp3	UTSW	19	5746645	missense	probably benign	0.08
R2446:Ltbp3	UTSW	19	5754022	missense	probably benign	0.02
R2449:Ltbp3	UTSW	19	5754022	missense	probably benign	0.02
R3056:Ltbp3	UTSW	19	5751406	missense	probably benign	0.11
R3080:Ltbp3	UTSW	19	5756888	frame shift	probably null
R3863:Ltbp3	UTSW	19	5754022	missense	probably benign	0.02
R3864:Ltbp3	UTSW	19	5754022	missense	probably benign	0.02
R3951:Ltbp3	UTSW	19	5756001	missense	probably damaging	1.00
R3961:Ltbp3	UTSW	19	5754022	missense	probably benign	0.02
R3962:Ltbp3	UTSW	19	5754022	missense	probably benign	0.02
R3963:Ltbp3	UTSW	19	5754022	missense	probably benign	0.02
R3972:Ltbp3	UTSW	19	5754022	missense	probably benign	0.02
R4028:Ltbp3	UTSW	19	5754022	missense	probably benign	0.02
R4031:Ltbp3	UTSW	19	5754022	missense	probably benign	0.02
R4041:Ltbp3	UTSW	19	5751871	missense	possibly damaging	0.95
R4060:Ltbp3	UTSW	19	5742320	missense	probably benign	0.41
R4296:Ltbp3	UTSW	19	5756582	critical splice acceptor site	probably null
R4525:Ltbp3	UTSW	19	5746359	missense	probably benign	0.09
R4660:Ltbp3	UTSW	19	5748786	splice site	probably null
R4794:Ltbp3	UTSW	19	5756679	missense	probably damaging	1.00
R4980:Ltbp3	UTSW	19	5753927	critical splice acceptor site	probably null
R5071:Ltbp3	UTSW	19	5756823	missense	probably damaging	1.00
R5702:Ltbp3	UTSW	19	5747821	missense	probably benign
R5771:Ltbp3	UTSW	19	5747544	missense	probably damaging	1.00
R6053:Ltbp3	UTSW	19	5752094	missense	probably damaging	0.98
R6321:Ltbp3	UTSW	19	5745657	missense	probably benign	0.09
R6339:Ltbp3	UTSW	19	5747477	missense	probably damaging	1.00
R6371:Ltbp3	UTSW	19	5745772	splice site	probably null
R6709:Ltbp3	UTSW	19	5747857	critical splice donor site	probably null
R7666:Ltbp3	UTSW	19	5747006	missense	possibly damaging	0.79
R8499:Ltbp3	UTSW	19	5748684	missense	probably benign	0.01
X0066:Ltbp3	UTSW	19	5751277	missense	probably benign	0.01
Z1177:Ltbp3	UTSW	19	5747730	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAAGTATCGCCACGGACTC -3'
(R):5'- CACAACTGGGATCTGGATGG -3'

Sequencing Primer
(F):5'- ACGGACTCTTGGGAACACTTGAC -3'
(R):5'- ATCTGGATGGCCTTGGAGC -3'

Posted On

2017-06-26