Incidental Mutation 'R6022:Phc3'
ID478981
Institutional Source Beutler Lab
Gene Symbol Phc3
Ensembl Gene ENSMUSG00000037652
Gene Namepolyhomeotic 3
SynonymsHPH3, EDR3, E030046K01Rik
MMRRC Submission 043256-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6022 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location30899371-30969415 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30930025 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 647 (S647P)
Ref Sequence ENSEMBL: ENSMUSP00000130142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046624] [ENSMUST00000064718] [ENSMUST00000099163] [ENSMUST00000108255] [ENSMUST00000129817] [ENSMUST00000152357] [ENSMUST00000168645] [ENSMUST00000177992]
Predicted Effect probably benign
Transcript: ENSMUST00000046624
SMART Domains Protein: ENSMUSP00000037862
Gene: ENSMUSG00000037652

DomainStartEndE-ValueType
low complexity region 18 40 N/A INTRINSIC
low complexity region 72 89 N/A INTRINSIC
low complexity region 92 142 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
low complexity region 206 224 N/A INTRINSIC
low complexity region 333 359 N/A INTRINSIC
low complexity region 393 419 N/A INTRINSIC
low complexity region 512 538 N/A INTRINSIC
low complexity region 564 578 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000064718
AA Change: S617P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065617
Gene: ENSMUSG00000037652
AA Change: S617P

DomainStartEndE-ValueType
low complexity region 18 40 N/A INTRINSIC
low complexity region 72 89 N/A INTRINSIC
low complexity region 92 142 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
low complexity region 206 224 N/A INTRINSIC
low complexity region 333 359 N/A INTRINSIC
low complexity region 393 419 N/A INTRINSIC
low complexity region 470 496 N/A INTRINSIC
low complexity region 522 536 N/A INTRINSIC
low complexity region 541 571 N/A INTRINSIC
low complexity region 610 618 N/A INTRINSIC
low complexity region 628 656 N/A INTRINSIC
PDB:2L8E|A 745 781 1e-8 PDB
low complexity region 849 868 N/A INTRINSIC
SAM 884 951 4.04e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099163
AA Change: S626P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000096767
Gene: ENSMUSG00000037652
AA Change: S626P

DomainStartEndE-ValueType
low complexity region 18 40 N/A INTRINSIC
low complexity region 72 89 N/A INTRINSIC
low complexity region 92 142 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
low complexity region 300 326 N/A INTRINSIC
low complexity region 360 386 N/A INTRINSIC
low complexity region 479 505 N/A INTRINSIC
low complexity region 531 545 N/A INTRINSIC
low complexity region 550 580 N/A INTRINSIC
low complexity region 619 627 N/A INTRINSIC
low complexity region 637 665 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108255
AA Change: S614P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103890
Gene: ENSMUSG00000037652
AA Change: S614P

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 80 130 N/A INTRINSIC
low complexity region 140 154 N/A INTRINSIC
low complexity region 288 314 N/A INTRINSIC
low complexity region 348 374 N/A INTRINSIC
low complexity region 467 493 N/A INTRINSIC
low complexity region 519 533 N/A INTRINSIC
low complexity region 538 568 N/A INTRINSIC
low complexity region 607 615 N/A INTRINSIC
low complexity region 625 653 N/A INTRINSIC
PDB:2L8E|A 742 778 8e-9 PDB
low complexity region 846 865 N/A INTRINSIC
SAM 881 948 4.04e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124472
Predicted Effect probably damaging
Transcript: ENSMUST00000129817
AA Change: S647P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114916
Gene: ENSMUSG00000037652
AA Change: S647P

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 80 130 N/A INTRINSIC
low complexity region 140 154 N/A INTRINSIC
low complexity region 194 212 N/A INTRINSIC
low complexity region 321 347 N/A INTRINSIC
low complexity region 381 407 N/A INTRINSIC
low complexity region 500 526 N/A INTRINSIC
low complexity region 552 566 N/A INTRINSIC
low complexity region 571 601 N/A INTRINSIC
low complexity region 640 648 N/A INTRINSIC
low complexity region 658 686 N/A INTRINSIC
PDB:2L8E|A 775 811 7e-9 PDB
low complexity region 879 898 N/A INTRINSIC
SAM 914 980 1.7e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152357
SMART Domains Protein: ENSMUSP00000117614
Gene: ENSMUSG00000037652

DomainStartEndE-ValueType
low complexity region 18 40 N/A INTRINSIC
low complexity region 72 89 N/A INTRINSIC
low complexity region 92 142 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
low complexity region 201 222 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168645
AA Change: S647P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130142
Gene: ENSMUSG00000037652
AA Change: S647P

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 80 130 N/A INTRINSIC
low complexity region 140 154 N/A INTRINSIC
low complexity region 194 212 N/A INTRINSIC
low complexity region 321 347 N/A INTRINSIC
low complexity region 381 407 N/A INTRINSIC
low complexity region 500 526 N/A INTRINSIC
low complexity region 552 566 N/A INTRINSIC
low complexity region 571 601 N/A INTRINSIC
low complexity region 640 648 N/A INTRINSIC
low complexity region 658 686 N/A INTRINSIC
PDB:2L8E|A 775 811 7e-9 PDB
low complexity region 879 898 N/A INTRINSIC
SAM 914 980 1.6e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177992
AA Change: S614P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136820
Gene: ENSMUSG00000037652
AA Change: S614P

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 80 130 N/A INTRINSIC
low complexity region 140 154 N/A INTRINSIC
low complexity region 288 314 N/A INTRINSIC
low complexity region 348 374 N/A INTRINSIC
low complexity region 467 493 N/A INTRINSIC
low complexity region 519 533 N/A INTRINSIC
low complexity region 538 568 N/A INTRINSIC
low complexity region 607 615 N/A INTRINSIC
low complexity region 625 653 N/A INTRINSIC
PDB:2L8E|A 742 778 8e-9 PDB
low complexity region 846 865 N/A INTRINSIC
SAM 881 948 4.04e-13 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T G 11: 9,290,759 F874C probably damaging Het
Adam9 T C 8: 25,003,305 T96A possibly damaging Het
Arhgef26 C T 3: 62,428,939 T633M probably damaging Het
Atxn2l A G 7: 126,496,435 probably null Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Brix1 C T 15: 10,476,589 R267H probably benign Het
Caskin1 T A 17: 24,496,735 F158I probably benign Het
Ces1g T A 8: 93,328,457 N204I probably damaging Het
Chd1 A G 17: 17,377,773 I41V probably benign Het
Crybg2 A T 4: 134,074,273 K915* probably null Het
Dock4 T C 12: 40,748,110 V911A probably benign Het
Dok5 A G 2: 170,879,222 Y302C probably damaging Het
Dpysl4 A T 7: 139,086,084 probably benign Het
Dsc3 A C 18: 19,966,338 V707G probably damaging Het
Endog A G 2: 30,172,909 Y187C possibly damaging Het
Fcrl5 A G 3: 87,455,763 T526A probably benign Het
Gcat T C 15: 79,042,278 V116A probably damaging Het
Gm10471 T G 5: 26,084,679 E250A probably benign Het
Herc1 A G 9: 66,483,685 D3975G probably damaging Het
Jmy G T 13: 93,453,578 probably null Het
Kif1b T C 4: 149,198,532 I1273V probably benign Het
Lrriq1 G T 10: 103,215,534 N452K possibly damaging Het
Lrrn3 T C 12: 41,453,430 E296G probably damaging Het
Marco G A 1: 120,488,565 L208F probably benign Het
Mme T A 3: 63,364,797 W606R probably damaging Het
Parp14 G A 16: 35,841,457 P1403S probably benign Het
Prx A G 7: 27,517,573 K500E probably damaging Het
Ptpn22 T A 3: 103,886,105 V524E probably benign Het
Ptprj A T 2: 90,471,323 I155K probably benign Het
Rad51ap2 A G 12: 11,458,522 E815G probably damaging Het
Rnf150 T C 8: 83,042,729 V381A probably benign Het
Rnf213 A G 11: 119,486,010 K5103R probably benign Het
Tecpr1 A T 5: 144,199,191 W961R possibly damaging Het
Tnn A T 1: 160,110,358 D932E probably benign Het
Tram2 G A 1: 21,079,137 probably benign Het
Trbv26 T A 6: 41,227,575 probably benign Het
Trmt11 A G 10: 30,587,501 I206T possibly damaging Het
Ttk T C 9: 83,839,322 Y87H probably damaging Het
Uri1 A T 7: 37,961,477 probably benign Het
Vmn1r173 A G 7: 23,702,835 D165G probably benign Het
Xpc A G 6: 91,499,636 S494P probably damaging Het
Zfp438 T A 18: 5,213,419 N513I probably damaging Het
Other mutations in Phc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Phc3 APN 3 30936475 missense probably damaging 0.98
IGL00985:Phc3 APN 3 30914197 missense probably benign 0.13
IGL01340:Phc3 APN 3 30929884 missense possibly damaging 0.85
IGL01450:Phc3 APN 3 30914504 missense probably damaging 1.00
IGL01546:Phc3 APN 3 30961739 missense probably damaging 1.00
IGL01918:Phc3 APN 3 30914416 critical splice donor site probably null
IGL02178:Phc3 APN 3 30929863 missense possibly damaging 0.47
IGL02210:Phc3 APN 3 30936709 missense probably damaging 0.99
IGL02330:Phc3 APN 3 30936381 missense probably damaging 1.00
IGL02516:Phc3 APN 3 30948793 missense probably damaging 1.00
IGL03030:Phc3 APN 3 30936853 missense probably damaging 1.00
See_saw UTSW 3 30937049 nonsense probably null
R1228:Phc3 UTSW 3 30922255 missense possibly damaging 0.71
R1239:Phc3 UTSW 3 30914130 missense probably damaging 1.00
R1319:Phc3 UTSW 3 30929869 missense probably damaging 0.97
R1521:Phc3 UTSW 3 30936575 missense possibly damaging 0.89
R1772:Phc3 UTSW 3 30961820 missense probably damaging 1.00
R1793:Phc3 UTSW 3 30948716 missense probably damaging 1.00
R1879:Phc3 UTSW 3 30914458 missense probably damaging 1.00
R2171:Phc3 UTSW 3 30950929 missense probably damaging 1.00
R2419:Phc3 UTSW 3 30950878 missense probably damaging 0.99
R2863:Phc3 UTSW 3 30914128 missense probably damaging 0.99
R2864:Phc3 UTSW 3 30914128 missense probably damaging 0.99
R3700:Phc3 UTSW 3 30914128 missense probably damaging 1.00
R3980:Phc3 UTSW 3 30936931 missense probably damaging 0.99
R4222:Phc3 UTSW 3 30936819 missense probably damaging 1.00
R4223:Phc3 UTSW 3 30936819 missense probably damaging 1.00
R4584:Phc3 UTSW 3 30965882 missense possibly damaging 0.46
R4928:Phc3 UTSW 3 30950919 missense probably damaging 1.00
R5100:Phc3 UTSW 3 30922199 missense possibly damaging 0.71
R5340:Phc3 UTSW 3 30907467 missense probably damaging 1.00
R5656:Phc3 UTSW 3 30965866 missense probably damaging 0.98
R5840:Phc3 UTSW 3 30936583 missense possibly damaging 0.95
R6061:Phc3 UTSW 3 30914529 missense probably damaging 1.00
R6177:Phc3 UTSW 3 30942565 missense probably damaging 1.00
R6188:Phc3 UTSW 3 30937049 nonsense probably null
R6866:Phc3 UTSW 3 30914531 nonsense probably null
R6870:Phc3 UTSW 3 30936761 missense probably damaging 1.00
R7155:Phc3 UTSW 3 30914197 missense probably benign 0.01
R7603:Phc3 UTSW 3 30907452 missense probably damaging 0.97
R7874:Phc3 UTSW 3 30936714 missense probably benign 0.00
R7957:Phc3 UTSW 3 30936714 missense probably benign 0.00
X0025:Phc3 UTSW 3 30965886 missense probably damaging 0.96
Z1176:Phc3 UTSW 3 30936597 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACGTGGGTCAAAATCTGTGG -3'
(R):5'- AGATGATATTTAGGGCATTTGCAGG -3'

Sequencing Primer
(F):5'- GTTTCACAATAGCCTGTGGAGG -3'
(R):5'- TTTGCAGGTTCTATGGGGAAAATAAG -3'
Posted On2017-06-26