Mutagenetix > Incidental Mutation

Incidental Mutation 'R6022:Tecpr1'

478989

Institutional Source

Beutler Lab

Gene Symbol

Tecpr1

Ensembl Gene

ENSMUSG00000066621

Gene Name

tectonin beta-propeller repeat containing 1

Synonyms

MMRRC Submission

043256-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6022 (G1)

Quality Score

222.009

Status

Not validated

Chromosome

Chromosomal Location

144194442-144223615 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 144199191 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 961 (W961R)

Ref Sequence

ENSEMBL: ENSMUSP00000082844 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060747] [ENSMUST00000085701]

AlphaFold

Q80VP0

Predicted Effect

probably benign
Transcript: ENSMUST00000060747

SMART Domains

Protein: ENSMUSP00000055493
Gene: ENSMUSG00000052271

Domain	Start	End	E-Value	Type
low complexity region	6	13	N/A	INTRINSIC
low complexity region	41	67	N/A	INTRINSIC
HLH	78	130	1.61e-18	SMART
low complexity region	136	148	N/A	INTRINSIC
low complexity region	151	166	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085701
AA Change: W961R

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000082844
Gene: ENSMUSG00000066621
AA Change: W961R

Domain	Start	End	E-Value	Type
TECPR	23	59	8.98e1	SMART
DysFN	64	125	6.72e-24	SMART
DysFC	137	170	1.89e-9	SMART
TECPR	192	225	1.79e-1	SMART
TECPR	234	270	2.5e-9	SMART
TECPR	279	317	4.99e-9	SMART
TECPR	326	361	2.42e-7	SMART
low complexity region	381	394	N/A	INTRINSIC
PH	614	724	1.69e-2	SMART
TECPR	711	750	1.88e-4	SMART
TECPR	766	800	3.27e-4	SMART
DysFN	821	882	2.95e-20	SMART
DysFC	893	926	1.66e-14	SMART
TECPR	940	974	1.69e1	SMART
TECPR	983	1019	1.45e-5	SMART
TECPR	1028	1065	1.51e-8	SMART
TECPR	1074	1109	1.59e-2	SMART
low complexity region	1125	1137	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125672

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140524

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147992

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151479

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153103

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 92.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tethering factor involved in autophagy. The encoded protein is found at autolysosomes, and is involved in targeting protein aggregates, damaged mitochondria, and bacterial pathogens for autophagy [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired selective autophagy and abnormal response to bacterial infection in MEFs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	G	11: 9,290,759	F874C	probably damaging	Het
Adam9	T	C	8: 25,003,305	T96A	possibly damaging	Het
Arhgef26	C	T	3: 62,428,939	T633M	probably damaging	Het
Atxn2l	A	G	7: 126,496,435		probably null	Het
AW209491	C	T	13: 14,637,780	A406V	probably benign	Het
Brix1	C	T	15: 10,476,589	R267H	probably benign	Het
Caskin1	T	A	17: 24,496,735	F158I	probably benign	Het
Ces1g	T	A	8: 93,328,457	N204I	probably damaging	Het
Chd1	A	G	17: 17,377,773	I41V	probably benign	Het
Crybg2	A	T	4: 134,074,273	K915*	probably null	Het
Dock4	T	C	12: 40,748,110	V911A	probably benign	Het
Dok5	A	G	2: 170,879,222	Y302C	probably damaging	Het
Dpysl4	A	T	7: 139,086,084		probably benign	Het
Dsc3	A	C	18: 19,966,338	V707G	probably damaging	Het
Endog	A	G	2: 30,172,909	Y187C	possibly damaging	Het
Fcrl5	A	G	3: 87,455,763	T526A	probably benign	Het
Gcat	T	C	15: 79,042,278	V116A	probably damaging	Het
Gm10471	T	G	5: 26,084,679	E250A	probably benign	Het
Herc1	A	G	9: 66,483,685	D3975G	probably damaging	Het
Jmy	G	T	13: 93,453,578		probably null	Het
Kif1b	T	C	4: 149,198,532	I1273V	probably benign	Het
Lrriq1	G	T	10: 103,215,534	N452K	possibly damaging	Het
Lrrn3	T	C	12: 41,453,430	E296G	probably damaging	Het
Marco	G	A	1: 120,488,565	L208F	probably benign	Het
Mme	T	A	3: 63,364,797	W606R	probably damaging	Het
Parp14	G	A	16: 35,841,457	P1403S	probably benign	Het
Phc3	A	G	3: 30,930,025	S647P	probably damaging	Het
Prx	A	G	7: 27,517,573	K500E	probably damaging	Het
Ptpn22	T	A	3: 103,886,105	V524E	probably benign	Het
Ptprj	A	T	2: 90,471,323	I155K	probably benign	Het
Rad51ap2	A	G	12: 11,458,522	E815G	probably damaging	Het
Rnf150	T	C	8: 83,042,729	V381A	probably benign	Het
Rnf213	A	G	11: 119,486,010	K5103R	probably benign	Het
Tnn	A	T	1: 160,110,358	D932E	probably benign	Het
Tram2	G	A	1: 21,079,137		probably benign	Het
Trbv26	T	A	6: 41,227,575		probably benign	Het
Trmt11	A	G	10: 30,587,501	I206T	possibly damaging	Het
Ttk	T	C	9: 83,839,322	Y87H	probably damaging	Het
Uri1	A	T	7: 37,961,477		probably benign	Het
Vmn1r173	A	G	7: 23,702,835	D165G	probably benign	Het
Xpc	A	G	6: 91,499,636	S494P	probably damaging	Het
Zfp438	T	A	18: 5,213,419	N513I	probably damaging	Het

Other mutations in Tecpr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01399:Tecpr1	APN	5	144208593	critical splice donor site	probably null
IGL01774:Tecpr1	APN	5	144211540	missense	probably damaging	0.97
IGL01960:Tecpr1	APN	5	144216919	missense	probably benign	0.00
IGL01973:Tecpr1	APN	5	144197988	splice site	probably benign
IGL02244:Tecpr1	APN	5	144210003	missense	probably benign
IGL02247:Tecpr1	APN	5	144206554	missense	possibly damaging	0.64
IGL02423:Tecpr1	APN	5	144203487	missense	possibly damaging	0.88
IGL02679:Tecpr1	APN	5	144206546	missense	probably benign	0.28
larghissimo	UTSW	5	144217257	missense	probably damaging	1.00
PIT4531001:Tecpr1	UTSW	5	144214067	missense	probably damaging	0.96
R0121:Tecpr1	UTSW	5	144210199	missense	probably benign	0.02
R0125:Tecpr1	UTSW	5	144197899	missense	probably damaging	1.00
R0194:Tecpr1	UTSW	5	144218517	missense	probably damaging	1.00
R0376:Tecpr1	UTSW	5	144207476	missense	possibly damaging	0.94
R0441:Tecpr1	UTSW	5	144195941	missense	probably benign
R0504:Tecpr1	UTSW	5	144214081	missense	probably damaging	0.99
R0538:Tecpr1	UTSW	5	144206274	missense	probably damaging	0.99
R0586:Tecpr1	UTSW	5	144217401	missense	probably damaging	1.00
R0607:Tecpr1	UTSW	5	144212590	missense	probably damaging	1.00
R0608:Tecpr1	UTSW	5	144211499	missense	probably damaging	1.00
R0656:Tecpr1	UTSW	5	144214053	splice site	probably null
R0835:Tecpr1	UTSW	5	144212592	missense	possibly damaging	0.81
R1080:Tecpr1	UTSW	5	144216929	missense	probably damaging	1.00
R1394:Tecpr1	UTSW	5	144206539	missense	possibly damaging	0.77
R1597:Tecpr1	UTSW	5	144214310	missense	probably benign	0.00
R1663:Tecpr1	UTSW	5	144197944	missense	probably benign	0.17
R1785:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R1786:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R1833:Tecpr1	UTSW	5	144208608	missense	probably damaging	0.99
R1883:Tecpr1	UTSW	5	144206529	missense	probably benign	0.03
R1988:Tecpr1	UTSW	5	144204697	missense	possibly damaging	0.94
R2130:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2131:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2132:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2133:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2172:Tecpr1	UTSW	5	144196417	missense	probably damaging	1.00
R2172:Tecpr1	UTSW	5	144211456	missense	probably benign	0.10
R2290:Tecpr1	UTSW	5	144214063	missense	probably damaging	0.99
R3691:Tecpr1	UTSW	5	144209979	missense	probably benign	0.10
R4027:Tecpr1	UTSW	5	144206259	missense	probably benign	0.41
R4587:Tecpr1	UTSW	5	144212590	missense	probably damaging	0.96
R4684:Tecpr1	UTSW	5	144207437	missense	probably benign	0.16
R4864:Tecpr1	UTSW	5	144214117	missense	probably benign	0.00
R4932:Tecpr1	UTSW	5	144204658	missense	probably damaging	0.97
R4955:Tecpr1	UTSW	5	144217257	missense	probably damaging	1.00
R5043:Tecpr1	UTSW	5	144197854	splice site	probably null
R5459:Tecpr1	UTSW	5	144207416	missense	probably damaging	1.00
R5579:Tecpr1	UTSW	5	144214344	missense	possibly damaging	0.55
R5677:Tecpr1	UTSW	5	144218633	nonsense	probably null
R5679:Tecpr1	UTSW	5	144207423	missense	possibly damaging	0.69
R5802:Tecpr1	UTSW	5	144206546	missense	probably benign	0.28
R6000:Tecpr1	UTSW	5	144211421	missense	probably benign	0.02
R6114:Tecpr1	UTSW	5	144204640	missense	possibly damaging	0.81
R6251:Tecpr1	UTSW	5	144198576	missense	probably damaging	0.97
R6372:Tecpr1	UTSW	5	144216958	missense	probably damaging	1.00
R6493:Tecpr1	UTSW	5	144209974	missense	probably benign
R7276:Tecpr1	UTSW	5	144217020	nonsense	probably null
R7314:Tecpr1	UTSW	5	144217332	missense	probably damaging	1.00
R7375:Tecpr1	UTSW	5	144208599	missense	possibly damaging	0.68
R7632:Tecpr1	UTSW	5	144218726	missense	probably benign	0.03
R7702:Tecpr1	UTSW	5	144203418	missense	probably damaging	1.00
R8135:Tecpr1	UTSW	5	144198602	missense	probably damaging	0.99
R8406:Tecpr1	UTSW	5	144200840	missense	probably damaging	1.00
R8844:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8856:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8857:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8866:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8903:Tecpr1	UTSW	5	144214027	intron	probably benign
R8926:Tecpr1	UTSW	5	144216962	missense	probably damaging	1.00
R9218:Tecpr1	UTSW	5	144217231	missense	possibly damaging	0.70
R9423:Tecpr1	UTSW	5	144218578	missense	probably damaging	0.98
RF001:Tecpr1	UTSW	5	144217386	missense	probably damaging	0.99
Z1176:Tecpr1	UTSW	5	144218591	missense	probably benign	0.28

Predicted Primers

PCR Primer
(F):5'- CGTGCCAATCTCATCCTTGG -3'
(R):5'- ATCTACCCCTAGCCTTGACAG -3'

Sequencing Primer
(F):5'- GGATTACATAGGATGTTCTGCCACC -3'
(R):5'- TTGACAGGGCGGTCCATCTC -3'

Posted On

2017-06-26