Incidental Mutation 'R6022:Tecpr1'
ID478989
Institutional Source Beutler Lab
Gene Symbol Tecpr1
Ensembl Gene ENSMUSG00000066621
Gene Nametectonin beta-propeller repeat containing 1
Synonyms
MMRRC Submission 043256-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6022 (G1)
Quality Score222.009
Status Not validated
Chromosome5
Chromosomal Location144194442-144223615 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 144199191 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 961 (W961R)
Ref Sequence ENSEMBL: ENSMUSP00000082844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060747] [ENSMUST00000085701]
Predicted Effect probably benign
Transcript: ENSMUST00000060747
SMART Domains Protein: ENSMUSP00000055493
Gene: ENSMUSG00000052271

DomainStartEndE-ValueType
low complexity region 6 13 N/A INTRINSIC
low complexity region 41 67 N/A INTRINSIC
HLH 78 130 1.61e-18 SMART
low complexity region 136 148 N/A INTRINSIC
low complexity region 151 166 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000085701
AA Change: W961R

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000082844
Gene: ENSMUSG00000066621
AA Change: W961R

DomainStartEndE-ValueType
TECPR 23 59 8.98e1 SMART
DysFN 64 125 6.72e-24 SMART
DysFC 137 170 1.89e-9 SMART
TECPR 192 225 1.79e-1 SMART
TECPR 234 270 2.5e-9 SMART
TECPR 279 317 4.99e-9 SMART
TECPR 326 361 2.42e-7 SMART
low complexity region 381 394 N/A INTRINSIC
PH 614 724 1.69e-2 SMART
TECPR 711 750 1.88e-4 SMART
TECPR 766 800 3.27e-4 SMART
DysFN 821 882 2.95e-20 SMART
DysFC 893 926 1.66e-14 SMART
TECPR 940 974 1.69e1 SMART
TECPR 983 1019 1.45e-5 SMART
TECPR 1028 1065 1.51e-8 SMART
TECPR 1074 1109 1.59e-2 SMART
low complexity region 1125 1137 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140524
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151479
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153103
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tethering factor involved in autophagy. The encoded protein is found at autolysosomes, and is involved in targeting protein aggregates, damaged mitochondria, and bacterial pathogens for autophagy [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired selective autophagy and abnormal response to bacterial infection in MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T G 11: 9,290,759 F874C probably damaging Het
Adam9 T C 8: 25,003,305 T96A possibly damaging Het
Arhgef26 C T 3: 62,428,939 T633M probably damaging Het
Atxn2l A G 7: 126,496,435 probably null Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Brix1 C T 15: 10,476,589 R267H probably benign Het
Caskin1 T A 17: 24,496,735 F158I probably benign Het
Ces1g T A 8: 93,328,457 N204I probably damaging Het
Chd1 A G 17: 17,377,773 I41V probably benign Het
Crybg2 A T 4: 134,074,273 K915* probably null Het
Dock4 T C 12: 40,748,110 V911A probably benign Het
Dok5 A G 2: 170,879,222 Y302C probably damaging Het
Dpysl4 A T 7: 139,086,084 probably benign Het
Dsc3 A C 18: 19,966,338 V707G probably damaging Het
Endog A G 2: 30,172,909 Y187C possibly damaging Het
Fcrl5 A G 3: 87,455,763 T526A probably benign Het
Gcat T C 15: 79,042,278 V116A probably damaging Het
Gm10471 T G 5: 26,084,679 E250A probably benign Het
Herc1 A G 9: 66,483,685 D3975G probably damaging Het
Jmy G T 13: 93,453,578 probably null Het
Kif1b T C 4: 149,198,532 I1273V probably benign Het
Lrriq1 G T 10: 103,215,534 N452K possibly damaging Het
Lrrn3 T C 12: 41,453,430 E296G probably damaging Het
Marco G A 1: 120,488,565 L208F probably benign Het
Mme T A 3: 63,364,797 W606R probably damaging Het
Parp14 G A 16: 35,841,457 P1403S probably benign Het
Phc3 A G 3: 30,930,025 S647P probably damaging Het
Prx A G 7: 27,517,573 K500E probably damaging Het
Ptpn22 T A 3: 103,886,105 V524E probably benign Het
Ptprj A T 2: 90,471,323 I155K probably benign Het
Rad51ap2 A G 12: 11,458,522 E815G probably damaging Het
Rnf150 T C 8: 83,042,729 V381A probably benign Het
Rnf213 A G 11: 119,486,010 K5103R probably benign Het
Tnn A T 1: 160,110,358 D932E probably benign Het
Tram2 G A 1: 21,079,137 probably benign Het
Trbv26 T A 6: 41,227,575 probably benign Het
Trmt11 A G 10: 30,587,501 I206T possibly damaging Het
Ttk T C 9: 83,839,322 Y87H probably damaging Het
Uri1 A T 7: 37,961,477 probably benign Het
Vmn1r173 A G 7: 23,702,835 D165G probably benign Het
Xpc A G 6: 91,499,636 S494P probably damaging Het
Zfp438 T A 18: 5,213,419 N513I probably damaging Het
Other mutations in Tecpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Tecpr1 APN 5 144208593 critical splice donor site probably null
IGL01774:Tecpr1 APN 5 144211540 missense probably damaging 0.97
IGL01960:Tecpr1 APN 5 144216919 missense probably benign 0.00
IGL01973:Tecpr1 APN 5 144197988 splice site probably benign
IGL02244:Tecpr1 APN 5 144210003 missense probably benign
IGL02247:Tecpr1 APN 5 144206554 missense possibly damaging 0.64
IGL02423:Tecpr1 APN 5 144203487 missense possibly damaging 0.88
IGL02679:Tecpr1 APN 5 144206546 missense probably benign 0.28
larghissimo UTSW 5 144217257 missense probably damaging 1.00
PIT4531001:Tecpr1 UTSW 5 144214067 missense probably damaging 0.96
R0121:Tecpr1 UTSW 5 144210199 missense probably benign 0.02
R0125:Tecpr1 UTSW 5 144197899 missense probably damaging 1.00
R0194:Tecpr1 UTSW 5 144218517 missense probably damaging 1.00
R0376:Tecpr1 UTSW 5 144207476 missense possibly damaging 0.94
R0441:Tecpr1 UTSW 5 144195941 missense probably benign
R0504:Tecpr1 UTSW 5 144214081 missense probably damaging 0.99
R0538:Tecpr1 UTSW 5 144206274 missense probably damaging 0.99
R0586:Tecpr1 UTSW 5 144217401 missense probably damaging 1.00
R0607:Tecpr1 UTSW 5 144212590 missense probably damaging 1.00
R0608:Tecpr1 UTSW 5 144211499 missense probably damaging 1.00
R0656:Tecpr1 UTSW 5 144214053 splice site probably null
R0835:Tecpr1 UTSW 5 144212592 missense possibly damaging 0.81
R1080:Tecpr1 UTSW 5 144216929 missense probably damaging 1.00
R1394:Tecpr1 UTSW 5 144206539 missense possibly damaging 0.77
R1597:Tecpr1 UTSW 5 144214310 missense probably benign 0.00
R1663:Tecpr1 UTSW 5 144197944 missense probably benign 0.17
R1785:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R1786:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R1833:Tecpr1 UTSW 5 144208608 missense probably damaging 0.99
R1883:Tecpr1 UTSW 5 144206529 missense probably benign 0.03
R1988:Tecpr1 UTSW 5 144204697 missense possibly damaging 0.94
R2130:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2131:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2132:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2133:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2172:Tecpr1 UTSW 5 144196417 missense probably damaging 1.00
R2172:Tecpr1 UTSW 5 144211456 missense probably benign 0.10
R2290:Tecpr1 UTSW 5 144214063 missense probably damaging 0.99
R3691:Tecpr1 UTSW 5 144209979 missense probably benign 0.10
R4027:Tecpr1 UTSW 5 144206259 missense probably benign 0.41
R4587:Tecpr1 UTSW 5 144212590 missense probably damaging 0.96
R4684:Tecpr1 UTSW 5 144207437 missense probably benign 0.16
R4864:Tecpr1 UTSW 5 144214117 missense probably benign 0.00
R4932:Tecpr1 UTSW 5 144204658 missense probably damaging 0.97
R4955:Tecpr1 UTSW 5 144217257 missense probably damaging 1.00
R5043:Tecpr1 UTSW 5 144197854 splice site probably null
R5459:Tecpr1 UTSW 5 144207416 missense probably damaging 1.00
R5579:Tecpr1 UTSW 5 144214344 missense possibly damaging 0.55
R5677:Tecpr1 UTSW 5 144218633 nonsense probably null
R5679:Tecpr1 UTSW 5 144207423 missense possibly damaging 0.69
R5802:Tecpr1 UTSW 5 144206546 missense probably benign 0.28
R6000:Tecpr1 UTSW 5 144211421 missense probably benign 0.02
R6114:Tecpr1 UTSW 5 144204640 missense possibly damaging 0.81
R6251:Tecpr1 UTSW 5 144198576 missense probably damaging 0.97
R6372:Tecpr1 UTSW 5 144216958 missense probably damaging 1.00
R6493:Tecpr1 UTSW 5 144209974 missense probably benign
R7276:Tecpr1 UTSW 5 144217020 nonsense probably null
R7314:Tecpr1 UTSW 5 144217332 missense probably damaging 1.00
R7375:Tecpr1 UTSW 5 144208599 missense possibly damaging 0.68
R7632:Tecpr1 UTSW 5 144218726 missense probably benign 0.03
R7702:Tecpr1 UTSW 5 144203418 missense probably damaging 1.00
R8135:Tecpr1 UTSW 5 144198602 missense probably damaging 0.99
R8406:Tecpr1 UTSW 5 144200840 missense probably damaging 1.00
R8844:Tecpr1 UTSW 5 144216299 missense possibly damaging 0.94
R8856:Tecpr1 UTSW 5 144216299 missense possibly damaging 0.94
R8857:Tecpr1 UTSW 5 144216299 missense possibly damaging 0.94
R8866:Tecpr1 UTSW 5 144216299 missense possibly damaging 0.94
R8926:Tecpr1 UTSW 5 144216962 missense probably damaging 1.00
RF001:Tecpr1 UTSW 5 144217386 missense probably damaging 0.99
Z1176:Tecpr1 UTSW 5 144218591 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- CGTGCCAATCTCATCCTTGG -3'
(R):5'- ATCTACCCCTAGCCTTGACAG -3'

Sequencing Primer
(F):5'- GGATTACATAGGATGTTCTGCCACC -3'
(R):5'- TTGACAGGGCGGTCCATCTC -3'
Posted On2017-06-26