Mutagenetix > Incidental Mutation

Incidental Mutation 'R6022:Rad51ap2'

479006

Institutional Source

Beutler Lab

Gene Symbol

Rad51ap2

Ensembl Gene

ENSMUSG00000086022

Gene Name

RAD51 associated protein 2

Synonyms

MMRRC Submission

043256-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6022 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

11456079-11462928 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 11458522 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 815 (E815G)

Ref Sequence

ENSEMBL: ENSMUSP00000128854 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124065]

AlphaFold

G3UW63

Predicted Effect

probably damaging
Transcript: ENSMUST00000124065
AA Change: E815G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128854
Gene: ENSMUSG00000086022
AA Change: E815G

Domain	Start	End	E-Value	Type
low complexity region	17	32	N/A	INTRINSIC
low complexity region	428	438	N/A	INTRINSIC
low complexity region	702	713	N/A	INTRINSIC
Pfam:RAD51_interact	937	975	1.3e-20	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 92.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	G	11: 9,290,759	F874C	probably damaging	Het
Adam9	T	C	8: 25,003,305	T96A	possibly damaging	Het
Arhgef26	C	T	3: 62,428,939	T633M	probably damaging	Het
Atxn2l	A	G	7: 126,496,435		probably null	Het
AW209491	C	T	13: 14,637,780	A406V	probably benign	Het
Brix1	C	T	15: 10,476,589	R267H	probably benign	Het
Caskin1	T	A	17: 24,496,735	F158I	probably benign	Het
Ces1g	T	A	8: 93,328,457	N204I	probably damaging	Het
Chd1	A	G	17: 17,377,773	I41V	probably benign	Het
Crybg2	A	T	4: 134,074,273	K915*	probably null	Het
Dock4	T	C	12: 40,748,110	V911A	probably benign	Het
Dok5	A	G	2: 170,879,222	Y302C	probably damaging	Het
Dpysl4	A	T	7: 139,086,084		probably benign	Het
Dsc3	A	C	18: 19,966,338	V707G	probably damaging	Het
Endog	A	G	2: 30,172,909	Y187C	possibly damaging	Het
Fcrl5	A	G	3: 87,455,763	T526A	probably benign	Het
Gcat	T	C	15: 79,042,278	V116A	probably damaging	Het
Gm10471	T	G	5: 26,084,679	E250A	probably benign	Het
Herc1	A	G	9: 66,483,685	D3975G	probably damaging	Het
Jmy	G	T	13: 93,453,578		probably null	Het
Kif1b	T	C	4: 149,198,532	I1273V	probably benign	Het
Lrriq1	G	T	10: 103,215,534	N452K	possibly damaging	Het
Lrrn3	T	C	12: 41,453,430	E296G	probably damaging	Het
Marco	G	A	1: 120,488,565	L208F	probably benign	Het
Mme	T	A	3: 63,364,797	W606R	probably damaging	Het
Parp14	G	A	16: 35,841,457	P1403S	probably benign	Het
Phc3	A	G	3: 30,930,025	S647P	probably damaging	Het
Prx	A	G	7: 27,517,573	K500E	probably damaging	Het
Ptpn22	T	A	3: 103,886,105	V524E	probably benign	Het
Ptprj	A	T	2: 90,471,323	I155K	probably benign	Het
Rnf150	T	C	8: 83,042,729	V381A	probably benign	Het
Rnf213	A	G	11: 119,486,010	K5103R	probably benign	Het
Tecpr1	A	T	5: 144,199,191	W961R	possibly damaging	Het
Tnn	A	T	1: 160,110,358	D932E	probably benign	Het
Tram2	G	A	1: 21,079,137		probably benign	Het
Trbv26	T	A	6: 41,227,575		probably benign	Het
Trmt11	A	G	10: 30,587,501	I206T	possibly damaging	Het
Ttk	T	C	9: 83,839,322	Y87H	probably damaging	Het
Uri1	A	T	7: 37,961,477		probably benign	Het
Vmn1r173	A	G	7: 23,702,835	D165G	probably benign	Het
Xpc	A	G	6: 91,499,636	S494P	probably damaging	Het
Zfp438	T	A	18: 5,213,419	N513I	probably damaging	Het

Other mutations in Rad51ap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01879:Rad51ap2	APN	12	11458138	missense	probably benign	0.10
IGL01908:Rad51ap2	APN	12	11458591	missense	probably damaging	1.00
IGL02415:Rad51ap2	APN	12	11456929	missense	possibly damaging	0.91
IGL02731:Rad51ap2	APN	12	11456896	missense	probably damaging	0.99
IGL03407:Rad51ap2	APN	12	11457197	missense	possibly damaging	0.96
R0190:Rad51ap2	UTSW	12	11458539	missense	probably benign	0.01
R0281:Rad51ap2	UTSW	12	11457042	missense	possibly damaging	0.93
R0564:Rad51ap2	UTSW	12	11457896	missense	probably benign	0.20
R0674:Rad51ap2	UTSW	12	11458817	critical splice donor site	probably null
R0699:Rad51ap2	UTSW	12	11457600	missense	probably benign	0.03
R1033:Rad51ap2	UTSW	12	11456251	missense	probably damaging	0.98
R1255:Rad51ap2	UTSW	12	11458094	missense	possibly damaging	0.54
R1572:Rad51ap2	UTSW	12	11457112	missense	probably damaging	0.99
R1746:Rad51ap2	UTSW	12	11457775	missense	probably benign
R1882:Rad51ap2	UTSW	12	11456250	missense	possibly damaging	0.85
R2038:Rad51ap2	UTSW	12	11457024	missense	possibly damaging	0.73
R2151:Rad51ap2	UTSW	12	11457985	missense	probably benign	0.02
R2152:Rad51ap2	UTSW	12	11457985	missense	probably benign	0.02
R2154:Rad51ap2	UTSW	12	11457985	missense	probably benign	0.02
R2159:Rad51ap2	UTSW	12	11457751	missense	possibly damaging	0.87
R2321:Rad51ap2	UTSW	12	11457057	missense	probably damaging	1.00
R2355:Rad51ap2	UTSW	12	11457108	missense	probably benign
R2393:Rad51ap2	UTSW	12	11457797	missense	probably damaging	0.98
R2407:Rad51ap2	UTSW	12	11458501	missense	probably damaging	0.99
R2518:Rad51ap2	UTSW	12	11457067	missense	probably damaging	0.99
R2929:Rad51ap2	UTSW	12	11457184	missense	probably benign	0.07
R3085:Rad51ap2	UTSW	12	11456757	missense	possibly damaging	0.53
R4009:Rad51ap2	UTSW	12	11457051	missense	probably benign	0.33
R4108:Rad51ap2	UTSW	12	11458395	missense	probably damaging	1.00
R4282:Rad51ap2	UTSW	12	11456464	missense	probably benign	0.01
R4536:Rad51ap2	UTSW	12	11457849	missense	possibly damaging	0.90
R4594:Rad51ap2	UTSW	12	11457880	missense	probably benign	0.01
R4678:Rad51ap2	UTSW	12	11456551	missense	probably damaging	0.96
R4679:Rad51ap2	UTSW	12	11456551	missense	probably damaging	0.96
R4810:Rad51ap2	UTSW	12	11457405	missense	probably damaging	1.00
R5151:Rad51ap2	UTSW	12	11457515	missense	probably benign	0.09
R5421:Rad51ap2	UTSW	12	11459367	nonsense	probably null
R5517:Rad51ap2	UTSW	12	11458312	missense	probably benign	0.19
R5786:Rad51ap2	UTSW	12	11456920	missense	probably damaging	1.00
R5884:Rad51ap2	UTSW	12	11457533	small deletion	probably benign
R5932:Rad51ap2	UTSW	12	11458386	missense	probably damaging	1.00
R6064:Rad51ap2	UTSW	12	11457417	missense	possibly damaging	0.80
R6112:Rad51ap2	UTSW	12	11457289	missense	probably benign	0.01
R6235:Rad51ap2	UTSW	12	11457516	missense	possibly damaging	0.70
R6282:Rad51ap2	UTSW	12	11457559	missense	probably benign	0.12
R6488:Rad51ap2	UTSW	12	11458160	missense	possibly damaging	0.56
R6668:Rad51ap2	UTSW	12	11457646	missense	probably benign	0.17
R6759:Rad51ap2	UTSW	12	11457144	missense	possibly damaging	0.91
R7030:Rad51ap2	UTSW	12	11457431	missense	possibly damaging	0.93
R7080:Rad51ap2	UTSW	12	11456365	missense	probably benign
R7105:Rad51ap2	UTSW	12	11458277	missense	possibly damaging	0.84
R7269:Rad51ap2	UTSW	12	11456806	missense	possibly damaging	0.67
R7286:Rad51ap2	UTSW	12	11457691	missense	probably benign	0.19
R7305:Rad51ap2	UTSW	12	11457343	missense	possibly damaging	0.68
R7451:Rad51ap2	UTSW	12	11457981	missense	probably benign	0.05
R7632:Rad51ap2	UTSW	12	11457115	missense	possibly damaging	0.85
R7833:Rad51ap2	UTSW	12	11456655	missense	probably benign
R7839:Rad51ap2	UTSW	12	11457237	missense	possibly damaging	0.83
R7953:Rad51ap2	UTSW	12	11462592	nonsense	probably null
R8040:Rad51ap2	UTSW	12	11458791	missense	probably benign	0.03
R8879:Rad51ap2	UTSW	12	11457400	missense	possibly damaging	0.55
R8963:Rad51ap2	UTSW	12	11456254	missense	possibly damaging	0.91
R9010:Rad51ap2	UTSW	12	11458674	missense	probably benign	0.01
R9328:Rad51ap2	UTSW	12	11457771	missense	probably benign	0.03
R9691:Rad51ap2	UTSW	12	11459412	missense	possibly damaging	0.70
R9712:Rad51ap2	UTSW	12	11457592	missense	possibly damaging	0.95
RF023:Rad51ap2	UTSW	12	11458075	missense	possibly damaging	0.94
X0026:Rad51ap2	UTSW	12	11458096	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- TGCAGTCAGCTTCGCTAGTG -3'
(R):5'- GAGACCTGCCTTCACATCAC -3'

Sequencing Primer
(F):5'- CAGTCAGCTTCGCTAGTGAGTAAG -3'
(R):5'- TGCCTTCACATCACAGGAC -3'

Posted On

2017-06-26