Incidental Mutation 'R6022:AW209491'
ID479009
Institutional Source Beutler Lab
Gene Symbol AW209491
Ensembl Gene ENSMUSG00000039182
Gene Nameexpressed sequence AW209491
Synonyms
MMRRC Submission 043256-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R6022 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location14630154-14639096 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 14637780 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 406 (A406V)
Ref Sequence ENSEMBL: ENSMUSP00000136376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038690] [ENSMUST00000178289] [ENSMUST00000221168] [ENSMUST00000222052]
Predicted Effect probably benign
Transcript: ENSMUST00000038690
AA Change: A406V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000041523
Gene: ENSMUSG00000039182
AA Change: A406V

DomainStartEndE-ValueType
Pfam:DUF1308 38 401 2.2e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178289
AA Change: A406V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000136376
Gene: ENSMUSG00000039182
AA Change: A406V

DomainStartEndE-ValueType
Pfam:DUF1308 37 401 1.1e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221168
Predicted Effect probably benign
Transcript: ENSMUST00000222052
Meta Mutation Damage Score 0.0614 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T G 11: 9,290,759 F874C probably damaging Het
Adam9 T C 8: 25,003,305 T96A possibly damaging Het
Arhgef26 C T 3: 62,428,939 T633M probably damaging Het
Atxn2l A G 7: 126,496,435 probably null Het
Brix1 C T 15: 10,476,589 R267H probably benign Het
Caskin1 T A 17: 24,496,735 F158I probably benign Het
Ces1g T A 8: 93,328,457 N204I probably damaging Het
Chd1 A G 17: 17,377,773 I41V probably benign Het
Crybg2 A T 4: 134,074,273 K915* probably null Het
Dock4 T C 12: 40,748,110 V911A probably benign Het
Dok5 A G 2: 170,879,222 Y302C probably damaging Het
Dpysl4 A T 7: 139,086,084 probably benign Het
Dsc3 A C 18: 19,966,338 V707G probably damaging Het
Endog A G 2: 30,172,909 Y187C possibly damaging Het
Fcrl5 A G 3: 87,455,763 T526A probably benign Het
Gcat T C 15: 79,042,278 V116A probably damaging Het
Gm10471 T G 5: 26,084,679 E250A probably benign Het
Herc1 A G 9: 66,483,685 D3975G probably damaging Het
Jmy G T 13: 93,453,578 probably null Het
Kif1b T C 4: 149,198,532 I1273V probably benign Het
Lrriq1 G T 10: 103,215,534 N452K possibly damaging Het
Lrrn3 T C 12: 41,453,430 E296G probably damaging Het
Marco G A 1: 120,488,565 L208F probably benign Het
Mme T A 3: 63,364,797 W606R probably damaging Het
Parp14 G A 16: 35,841,457 P1403S probably benign Het
Phc3 A G 3: 30,930,025 S647P probably damaging Het
Prx A G 7: 27,517,573 K500E probably damaging Het
Ptpn22 T A 3: 103,886,105 V524E probably benign Het
Ptprj A T 2: 90,471,323 I155K probably benign Het
Rad51ap2 A G 12: 11,458,522 E815G probably damaging Het
Rnf150 T C 8: 83,042,729 V381A probably benign Het
Rnf213 A G 11: 119,486,010 K5103R probably benign Het
Tecpr1 A T 5: 144,199,191 W961R possibly damaging Het
Tnn A T 1: 160,110,358 D932E probably benign Het
Tram2 G A 1: 21,079,137 probably benign Het
Trbv26 T A 6: 41,227,575 probably benign Het
Trmt11 A G 10: 30,587,501 I206T possibly damaging Het
Ttk T C 9: 83,839,322 Y87H probably damaging Het
Uri1 A T 7: 37,961,477 probably benign Het
Vmn1r173 A G 7: 23,702,835 D165G probably benign Het
Xpc A G 6: 91,499,636 S494P probably damaging Het
Zfp438 T A 18: 5,213,419 N513I probably damaging Het
Other mutations in AW209491
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:AW209491 APN 13 14637075 missense probably damaging 0.98
IGL02634:AW209491 APN 13 14637683 missense probably damaging 0.99
IGL02635:AW209491 APN 13 14637267 missense possibly damaging 0.46
IGL03401:AW209491 APN 13 14637456 missense probably benign
R0067:AW209491 UTSW 13 14637743 missense probably benign 0.24
R0067:AW209491 UTSW 13 14637743 missense probably benign 0.24
R0536:AW209491 UTSW 13 14636973 missense probably damaging 1.00
R0539:AW209491 UTSW 13 14637732 missense probably damaging 1.00
R0845:AW209491 UTSW 13 14637022 missense probably damaging 1.00
R1851:AW209491 UTSW 13 14636733 missense possibly damaging 0.73
R4110:AW209491 UTSW 13 14637573 missense probably damaging 1.00
R4379:AW209491 UTSW 13 14637827 makesense probably null
R5153:AW209491 UTSW 13 14637179 missense probably benign
R5987:AW209491 UTSW 13 14637780 missense probably benign 0.00
R5988:AW209491 UTSW 13 14637780 missense probably benign 0.00
R5990:AW209491 UTSW 13 14637780 missense probably benign 0.00
R6019:AW209491 UTSW 13 14637780 missense probably benign 0.00
R6021:AW209491 UTSW 13 14637780 missense probably benign 0.00
R6160:AW209491 UTSW 13 14636721 missense probably damaging 0.99
R6179:AW209491 UTSW 13 14637083 missense possibly damaging 0.92
R6194:AW209491 UTSW 13 14637120 missense possibly damaging 0.89
R7594:AW209491 UTSW 13 14637246 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCCTTGAGACTAGTGGCAAG -3'
(R):5'- GGATACATAAGACTGTCAATTGGG -3'

Sequencing Primer
(F):5'- GTGGCAAGTTCAAAAATTAATAGCCG -3'
(R):5'- ATATATGGGAAGGCCAGC -3'
Posted On2017-06-26