Incidental Mutation 'R6022:Parp14'
ID479012
Institutional Source Beutler Lab
Gene Symbol Parp14
Ensembl Gene ENSMUSG00000034422
Gene Namepoly (ADP-ribose) polymerase family, member 14
Synonymscollaborator of Stat6, 1600029O10Rik, CoaSt6
MMRRC Submission 043256-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R6022 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location35832874-35871544 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35841457 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 1403 (P1403S)
Ref Sequence ENSEMBL: ENSMUSP00000037657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042665]
PDB Structure
Solution structure of WWE domain in Parp14 protein [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000042665
AA Change: P1403S

PolyPhen 2 Score 0.145 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000037657
Gene: ENSMUSG00000034422
AA Change: P1403S

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
low complexity region 93 115 N/A INTRINSIC
RRM 228 297 4.71e-2 SMART
coiled coil region 443 468 N/A INTRINSIC
Blast:A1pp 693 746 6e-6 BLAST
low complexity region 771 795 N/A INTRINSIC
A1pp 814 948 7.62e-41 SMART
A1pp 1026 1160 5.88e-24 SMART
A1pp 1239 1358 6.82e-20 SMART
PDB:1X4R|A 1532 1619 9e-53 PDB
Pfam:PARP 1632 1817 2.5e-29 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the poly(ADP-ribose) polymerase (PARP) protein family. The encoded anti-apoptotic protein may regulate aerobic glycolysis and promote survival of cancer cells. Increased expression of this gene has been reported in a variety of tumor types. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit altered B cell subsets and inability to respond to the apoptosis protective affects of IL4. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T G 11: 9,290,759 F874C probably damaging Het
Adam9 T C 8: 25,003,305 T96A possibly damaging Het
Arhgef26 C T 3: 62,428,939 T633M probably damaging Het
Atxn2l A G 7: 126,496,435 probably null Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Brix1 C T 15: 10,476,589 R267H probably benign Het
Caskin1 T A 17: 24,496,735 F158I probably benign Het
Ces1g T A 8: 93,328,457 N204I probably damaging Het
Chd1 A G 17: 17,377,773 I41V probably benign Het
Crybg2 A T 4: 134,074,273 K915* probably null Het
Dock4 T C 12: 40,748,110 V911A probably benign Het
Dok5 A G 2: 170,879,222 Y302C probably damaging Het
Dpysl4 A T 7: 139,086,084 probably benign Het
Dsc3 A C 18: 19,966,338 V707G probably damaging Het
Endog A G 2: 30,172,909 Y187C possibly damaging Het
Fcrl5 A G 3: 87,455,763 T526A probably benign Het
Gcat T C 15: 79,042,278 V116A probably damaging Het
Gm10471 T G 5: 26,084,679 E250A probably benign Het
Herc1 A G 9: 66,483,685 D3975G probably damaging Het
Jmy G T 13: 93,453,578 probably null Het
Kif1b T C 4: 149,198,532 I1273V probably benign Het
Lrriq1 G T 10: 103,215,534 N452K possibly damaging Het
Lrrn3 T C 12: 41,453,430 E296G probably damaging Het
Marco G A 1: 120,488,565 L208F probably benign Het
Mme T A 3: 63,364,797 W606R probably damaging Het
Phc3 A G 3: 30,930,025 S647P probably damaging Het
Prx A G 7: 27,517,573 K500E probably damaging Het
Ptpn22 T A 3: 103,886,105 V524E probably benign Het
Ptprj A T 2: 90,471,323 I155K probably benign Het
Rad51ap2 A G 12: 11,458,522 E815G probably damaging Het
Rnf150 T C 8: 83,042,729 V381A probably benign Het
Rnf213 A G 11: 119,486,010 K5103R probably benign Het
Tecpr1 A T 5: 144,199,191 W961R possibly damaging Het
Tnn A T 1: 160,110,358 D932E probably benign Het
Tram2 G A 1: 21,079,137 probably benign Het
Trbv26 T A 6: 41,227,575 probably benign Het
Trmt11 A G 10: 30,587,501 I206T possibly damaging Het
Ttk T C 9: 83,839,322 Y87H probably damaging Het
Uri1 A T 7: 37,961,477 probably benign Het
Vmn1r173 A G 7: 23,702,835 D165G probably benign Het
Xpc A G 6: 91,499,636 S494P probably damaging Het
Zfp438 T A 18: 5,213,419 N513I probably damaging Het
Other mutations in Parp14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Parp14 APN 16 35841075 missense probably benign 0.00
IGL00497:Parp14 APN 16 35834836 missense probably damaging 1.00
IGL00754:Parp14 APN 16 35839371 missense probably benign 0.15
IGL00960:Parp14 APN 16 35841219 missense probably benign 0.20
IGL01321:Parp14 APN 16 35856559 missense probably benign
IGL01397:Parp14 APN 16 35858728 missense probably benign 0.19
IGL01591:Parp14 APN 16 35858507 missense possibly damaging 0.71
IGL01728:Parp14 APN 16 35857435 missense probably damaging 1.00
IGL01734:Parp14 APN 16 35858600 missense probably benign 0.00
IGL02156:Parp14 APN 16 35858597 missense probably benign 0.13
IGL02951:Parp14 APN 16 35858533 missense probably benign 0.06
IGL03067:Parp14 APN 16 35856508 missense probably benign 0.10
IGL03135:Parp14 APN 16 35858011 missense probably damaging 1.00
IGL03141:Parp14 APN 16 35839293 missense probably benign 0.00
IGL03146:Parp14 APN 16 35858453 nonsense probably null
IGL03333:Parp14 APN 16 35841430 missense probably benign 0.08
IGL03391:Parp14 APN 16 35858270 missense probably benign
thurston UTSW 16 35844415 splice site probably benign
PIT4585001:Parp14 UTSW 16 35858605 missense probably benign 0.03
R0306:Parp14 UTSW 16 35856574 missense probably benign
R0506:Parp14 UTSW 16 35841409 missense possibly damaging 0.70
R0586:Parp14 UTSW 16 35841012 missense probably benign 0.00
R0606:Parp14 UTSW 16 35856760 missense probably benign 0.09
R0612:Parp14 UTSW 16 35856760 missense probably benign 0.09
R0699:Parp14 UTSW 16 35860585 missense probably damaging 1.00
R0786:Parp14 UTSW 16 35840802 missense possibly damaging 0.86
R0883:Parp14 UTSW 16 35858518 missense probably benign 0.03
R0900:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1087:Parp14 UTSW 16 35858288 missense probably damaging 1.00
R1104:Parp14 UTSW 16 35844415 splice site probably benign
R1120:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1134:Parp14 UTSW 16 35834902 missense probably damaging 1.00
R1153:Parp14 UTSW 16 35857671 missense possibly damaging 0.49
R1159:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1160:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1237:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1238:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1239:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1423:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1511:Parp14 UTSW 16 35857224 missense probably benign 0.00
R1518:Parp14 UTSW 16 35856638 missense possibly damaging 0.79
R1619:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1707:Parp14 UTSW 16 35857849 missense probably damaging 1.00
R1792:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1831:Parp14 UTSW 16 35858588 missense possibly damaging 0.77
R1840:Parp14 UTSW 16 35863449 missense probably damaging 1.00
R1889:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1902:Parp14 UTSW 16 35853518 critical splice donor site probably null
R1943:Parp14 UTSW 16 35836129 missense probably damaging 1.00
R1954:Parp14 UTSW 16 35858301 missense probably benign 0.08
R2115:Parp14 UTSW 16 35858534 missense probably benign 0.16
R2216:Parp14 UTSW 16 35857205 missense probably benign 0.00
R2519:Parp14 UTSW 16 35858203 missense possibly damaging 0.95
R3851:Parp14 UTSW 16 35853748 missense possibly damaging 0.92
R4052:Parp14 UTSW 16 35858401 missense probably benign 0.05
R4671:Parp14 UTSW 16 35858321 missense probably benign 0.00
R4867:Parp14 UTSW 16 35857327 missense probably benign 0.01
R4941:Parp14 UTSW 16 35846033 missense probably benign
R4992:Parp14 UTSW 16 35841142 missense probably benign 0.05
R5055:Parp14 UTSW 16 35844363 missense probably benign 0.00
R5073:Parp14 UTSW 16 35834707 missense probably damaging 0.99
R5170:Parp14 UTSW 16 35857279 missense probably benign 0.21
R5422:Parp14 UTSW 16 35866175 missense probably benign 0.01
R5543:Parp14 UTSW 16 35834767 missense probably benign 0.00
R5549:Parp14 UTSW 16 35841135 missense probably benign 0.00
R5553:Parp14 UTSW 16 35856936 missense probably benign 0.01
R5691:Parp14 UTSW 16 35863539 missense probably benign 0.12
R5774:Parp14 UTSW 16 35858410 missense probably damaging 1.00
R5855:Parp14 UTSW 16 35840927 nonsense probably null
R5942:Parp14 UTSW 16 35839367 missense probably damaging 0.98
R5990:Parp14 UTSW 16 35841457 missense probably benign 0.14
R5991:Parp14 UTSW 16 35841457 missense probably benign 0.14
R6018:Parp14 UTSW 16 35841457 missense probably benign 0.14
R6075:Parp14 UTSW 16 35857019 missense probably damaging 0.99
R6395:Parp14 UTSW 16 35856548 missense probably benign 0.00
R6525:Parp14 UTSW 16 35860441 missense probably benign 0.05
R6683:Parp14 UTSW 16 35834677 missense probably damaging 1.00
R7525:Parp14 UTSW 16 35857491 missense probably benign 0.00
R8011:Parp14 UTSW 16 35856634 missense probably benign 0.00
X0026:Parp14 UTSW 16 35857157 nonsense probably null
X0060:Parp14 UTSW 16 35834707 missense probably damaging 0.99
Z1088:Parp14 UTSW 16 35841586 missense probably damaging 1.00
Z1177:Parp14 UTSW 16 35845338 missense probably damaging 1.00
Z1177:Parp14 UTSW 16 35871203 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ACATACCTGGAAAACTGTGTGC -3'
(R):5'- AGGAAATGCTCAACAGGACC -3'

Sequencing Primer
(F):5'- CCAAAACCAGGGTGTTCTTTTTG -3'
(R):5'- CAGGACCCAAACGTAGTAGC -3'
Posted On2017-06-26