Mutagenetix > Incidental Mutation

Incidental Mutation 'R6022:Dsc3'

479016

Institutional Source

Beutler Lab

Gene Symbol

Dsc3

Ensembl Gene

ENSMUSG00000059898

Gene Name

desmocollin 3

Synonyms

MMRRC Submission

043256-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6022 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

19960930-20002351 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 19966338 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 707 (V707G)

Ref Sequence

ENSEMBL: ENSMUSP00000153261 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115848] [ENSMUST00000225110]

AlphaFold

P55850

Predicted Effect

probably damaging
Transcript: ENSMUST00000115848
AA Change: V707G

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000111514
Gene: ENSMUSG00000059898
AA Change: V707G

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	9.08e-41	SMART
CA	156	241	4.99e-11	SMART
CA	265	353	7.79e-22	SMART
CA	376	471	2.66e-6	SMART
CA	494	576	4.58e-19	SMART
CA	595	677	3.02e-2	SMART
transmembrane domain	692	714	N/A	INTRINSIC
Pfam:Cadherin_C	778	895	1.1e-8	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000225110
AA Change: V707G

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 92.7%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of proteins that mediates adhesion in desmosomes. Together with desmogleins, the encoded protein forms the transmembrane core of desmosomes, a multiprotein complex involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. Mice lacking the encoded protein exhibit a pre-implantation lethal phenotype. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. This gene encodes distinct isoforms, some or all of which may undergo similar processing to generate the mature protein. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice die before implantation. Heterozygous mice do not display any gross abnormalities and have normal epidermal development and keratinocyte differentiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	G	11: 9,290,759	F874C	probably damaging	Het
Adam9	T	C	8: 25,003,305	T96A	possibly damaging	Het
Arhgef26	C	T	3: 62,428,939	T633M	probably damaging	Het
Atxn2l	A	G	7: 126,496,435		probably null	Het
AW209491	C	T	13: 14,637,780	A406V	probably benign	Het
Brix1	C	T	15: 10,476,589	R267H	probably benign	Het
Caskin1	T	A	17: 24,496,735	F158I	probably benign	Het
Ces1g	T	A	8: 93,328,457	N204I	probably damaging	Het
Chd1	A	G	17: 17,377,773	I41V	probably benign	Het
Crybg2	A	T	4: 134,074,273	K915*	probably null	Het
Dock4	T	C	12: 40,748,110	V911A	probably benign	Het
Dok5	A	G	2: 170,879,222	Y302C	probably damaging	Het
Dpysl4	A	T	7: 139,086,084		probably benign	Het
Endog	A	G	2: 30,172,909	Y187C	possibly damaging	Het
Fcrl5	A	G	3: 87,455,763	T526A	probably benign	Het
Gcat	T	C	15: 79,042,278	V116A	probably damaging	Het
Gm10471	T	G	5: 26,084,679	E250A	probably benign	Het
Herc1	A	G	9: 66,483,685	D3975G	probably damaging	Het
Jmy	G	T	13: 93,453,578		probably null	Het
Kif1b	T	C	4: 149,198,532	I1273V	probably benign	Het
Lrriq1	G	T	10: 103,215,534	N452K	possibly damaging	Het
Lrrn3	T	C	12: 41,453,430	E296G	probably damaging	Het
Marco	G	A	1: 120,488,565	L208F	probably benign	Het
Mme	T	A	3: 63,364,797	W606R	probably damaging	Het
Parp14	G	A	16: 35,841,457	P1403S	probably benign	Het
Phc3	A	G	3: 30,930,025	S647P	probably damaging	Het
Prx	A	G	7: 27,517,573	K500E	probably damaging	Het
Ptpn22	T	A	3: 103,886,105	V524E	probably benign	Het
Ptprj	A	T	2: 90,471,323	I155K	probably benign	Het
Rad51ap2	A	G	12: 11,458,522	E815G	probably damaging	Het
Rnf150	T	C	8: 83,042,729	V381A	probably benign	Het
Rnf213	A	G	11: 119,486,010	K5103R	probably benign	Het
Tecpr1	A	T	5: 144,199,191	W961R	possibly damaging	Het
Tnn	A	T	1: 160,110,358	D932E	probably benign	Het
Tram2	G	A	1: 21,079,137		probably benign	Het
Trbv26	T	A	6: 41,227,575		probably benign	Het
Trmt11	A	G	10: 30,587,501	I206T	possibly damaging	Het
Ttk	T	C	9: 83,839,322	Y87H	probably damaging	Het
Uri1	A	T	7: 37,961,477		probably benign	Het
Vmn1r173	A	G	7: 23,702,835	D165G	probably benign	Het
Xpc	A	G	6: 91,499,636	S494P	probably damaging	Het
Zfp438	T	A	18: 5,213,419	N513I	probably damaging	Het

Other mutations in Dsc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00949:Dsc3	APN	18	19985631	missense	probably null	1.00
IGL01978:Dsc3	APN	18	19974196	missense	possibly damaging	0.79
IGL02101:Dsc3	APN	18	20001906	missense	probably benign	0.01
IGL02165:Dsc3	APN	18	19983652	missense	probably benign	0.06
IGL02543:Dsc3	APN	18	19965828	missense	probably benign	0.11
IGL02970:Dsc3	APN	18	19968260	missense	probably damaging	1.00
IGL03097:Dsc3	UTSW	18	19974048	missense	probably benign	0.30
R0133:Dsc3	UTSW	18	19971582	missense	probably damaging	0.96
R0304:Dsc3	UTSW	18	19981241	missense	probably damaging	1.00
R0360:Dsc3	UTSW	18	19971582	missense	possibly damaging	0.79
R0673:Dsc3	UTSW	18	19989590	missense	probably damaging	1.00
R0826:Dsc3	UTSW	18	19981172	missense	probably damaging	0.99
R1120:Dsc3	UTSW	18	19986977	missense	probably benign	0.05
R1491:Dsc3	UTSW	18	19987034	missense	probably damaging	0.99
R1667:Dsc3	UTSW	18	19991560	missense	possibly damaging	0.58
R1688:Dsc3	UTSW	18	19966227	missense	probably damaging	1.00
R1792:Dsc3	UTSW	18	19986998	missense	probably damaging	1.00
R1858:Dsc3	UTSW	18	19965716	missense	probably damaging	0.97
R1965:Dsc3	UTSW	18	19980672	missense	probably damaging	1.00
R1988:Dsc3	UTSW	18	19965846	missense	possibly damaging	0.86
R2049:Dsc3	UTSW	18	19989680	missense	possibly damaging	0.65
R2127:Dsc3	UTSW	18	19968354	missense	probably benign	0.00
R2143:Dsc3	UTSW	18	19980686	missense	possibly damaging	0.81
R2144:Dsc3	UTSW	18	19980686	missense	possibly damaging	0.81
R2148:Dsc3	UTSW	18	19965638	missense	probably damaging	0.99
R3038:Dsc3	UTSW	18	19991560	missense	possibly damaging	0.58
R3872:Dsc3	UTSW	18	19971508	missense	probably damaging	0.99
R4229:Dsc3	UTSW	18	19965821	missense	probably damaging	1.00
R4298:Dsc3	UTSW	18	19980754	missense	possibly damaging	0.62
R4491:Dsc3	UTSW	18	20001865	missense	probably benign	0.30
R4590:Dsc3	UTSW	18	19989695	missense	probably damaging	1.00
R4615:Dsc3	UTSW	18	19971488	missense	possibly damaging	0.67
R5316:Dsc3	UTSW	18	19963541	missense	possibly damaging	0.67
R5758:Dsc3	UTSW	18	19989534	missense	probably damaging	1.00
R5796:Dsc3	UTSW	18	19971501	missense	probably benign	0.01
R5916:Dsc3	UTSW	18	19987020	missense	probably damaging	1.00
R6233:Dsc3	UTSW	18	19965795	missense	possibly damaging	0.77
R6351:Dsc3	UTSW	18	19966291	missense	probably benign	0.05
R6971:Dsc3	UTSW	18	19966218	critical splice donor site	probably null
R7261:Dsc3	UTSW	18	19980757	nonsense	probably null
R7442:Dsc3	UTSW	18	19981156	missense	probably damaging	1.00
R7795:Dsc3	UTSW	18	19966231	missense	probably damaging	1.00
R8051:Dsc3	UTSW	18	19981213	missense	probably damaging	1.00
R8531:Dsc3	UTSW	18	19968392	missense	probably benign
R8531:Dsc3	UTSW	18	19981217	missense	probably damaging	1.00
R8872:Dsc3	UTSW	18	19989622	missense	probably benign	0.02
R8927:Dsc3	UTSW	18	19974177	missense	probably benign
R8928:Dsc3	UTSW	18	19974177	missense	probably benign
R9140:Dsc3	UTSW	18	19989559	missense	probably benign	0.01
R9493:Dsc3	UTSW	18	19989695	nonsense	probably null
X0061:Dsc3	UTSW	18	19989627	missense	probably damaging	1.00
Z1177:Dsc3	UTSW	18	19966315	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ATTCACTCCTACTAACTTCACAGG -3'
(R):5'- ACAATGCACTTGTGATTACTGC -3'

Sequencing Primer
(F):5'- TCCTACTAACTTCACAGGGATGG -3'
(R):5'- CTGCACATTTCAAATTGTGTCTG -3'

Posted On

2017-06-26