Incidental Mutation 'R6022:Dsc3'
ID 479016
Institutional Source Beutler Lab
Gene Symbol Dsc3
Ensembl Gene ENSMUSG00000059898
Gene Name desmocollin 3
Synonyms 5430426I24Rik
MMRRC Submission 043256-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6022 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 20093987-20135408 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 20099395 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 707 (V707G)
Ref Sequence ENSEMBL: ENSMUSP00000153261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115848] [ENSMUST00000225110]
AlphaFold P55850
Predicted Effect probably damaging
Transcript: ENSMUST00000115848
AA Change: V707G

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111514
Gene: ENSMUSG00000059898
AA Change: V707G

DomainStartEndE-ValueType
Cadherin_pro 31 113 9.08e-41 SMART
CA 156 241 4.99e-11 SMART
CA 265 353 7.79e-22 SMART
CA 376 471 2.66e-6 SMART
CA 494 576 4.58e-19 SMART
CA 595 677 3.02e-2 SMART
transmembrane domain 692 714 N/A INTRINSIC
Pfam:Cadherin_C 778 895 1.1e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000225110
AA Change: V707G

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that mediates adhesion in desmosomes. Together with desmogleins, the encoded protein forms the transmembrane core of desmosomes, a multiprotein complex involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. Mice lacking the encoded protein exhibit a pre-implantation lethal phenotype. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. This gene encodes distinct isoforms, some or all of which may undergo similar processing to generate the mature protein. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice die before implantation. Heterozygous mice do not display any gross abnormalities and have normal epidermal development and keratinocyte differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T G 11: 9,240,759 (GRCm39) F874C probably damaging Het
Adam9 T C 8: 25,493,321 (GRCm39) T96A possibly damaging Het
Arhgef26 C T 3: 62,336,360 (GRCm39) T633M probably damaging Het
Atxn2l A G 7: 126,095,607 (GRCm39) probably null Het
AW209491 C T 13: 14,812,365 (GRCm39) A406V probably benign Het
Brix1 C T 15: 10,476,675 (GRCm39) R267H probably benign Het
Caskin1 T A 17: 24,715,709 (GRCm39) F158I probably benign Het
Ces1g T A 8: 94,055,085 (GRCm39) N204I probably damaging Het
Chd1 A G 17: 17,598,035 (GRCm39) I41V probably benign Het
Crybg2 A T 4: 133,801,584 (GRCm39) K915* probably null Het
Dock4 T C 12: 40,798,109 (GRCm39) V911A probably benign Het
Dok5 A G 2: 170,721,142 (GRCm39) Y302C probably damaging Het
Dpysl4 A T 7: 138,666,000 (GRCm39) probably benign Het
Endog A G 2: 30,062,921 (GRCm39) Y187C possibly damaging Het
Fcrl5 A G 3: 87,363,070 (GRCm39) T526A probably benign Het
Gcat T C 15: 78,926,478 (GRCm39) V116A probably damaging Het
Herc1 A G 9: 66,390,967 (GRCm39) D3975G probably damaging Het
Jmy G T 13: 93,590,086 (GRCm39) probably null Het
Kif1b T C 4: 149,282,989 (GRCm39) I1273V probably benign Het
Lrriq1 G T 10: 103,051,395 (GRCm39) N452K possibly damaging Het
Lrrn3 T C 12: 41,503,429 (GRCm39) E296G probably damaging Het
Marco G A 1: 120,416,294 (GRCm39) L208F probably benign Het
Mme T A 3: 63,272,218 (GRCm39) W606R probably damaging Het
Parp14 G A 16: 35,661,827 (GRCm39) P1403S probably benign Het
Phc3 A G 3: 30,984,174 (GRCm39) S647P probably damaging Het
Prx A G 7: 27,216,998 (GRCm39) K500E probably damaging Het
Ptpn22 T A 3: 103,793,421 (GRCm39) V524E probably benign Het
Ptprj A T 2: 90,301,667 (GRCm39) I155K probably benign Het
Rad51ap2 A G 12: 11,508,523 (GRCm39) E815G probably damaging Het
Rnf150 T C 8: 83,769,358 (GRCm39) V381A probably benign Het
Rnf213 A G 11: 119,376,836 (GRCm39) K5103R probably benign Het
Speer4a2 T G 5: 26,289,677 (GRCm39) E250A probably benign Het
Tecpr1 A T 5: 144,136,009 (GRCm39) W961R possibly damaging Het
Tnn A T 1: 159,937,928 (GRCm39) D932E probably benign Het
Tram2 G A 1: 21,149,361 (GRCm39) probably benign Het
Trbv26 T A 6: 41,204,509 (GRCm39) probably benign Het
Trmt11 A G 10: 30,463,497 (GRCm39) I206T possibly damaging Het
Ttk T C 9: 83,721,375 (GRCm39) Y87H probably damaging Het
Uri1 A T 7: 37,660,902 (GRCm39) probably benign Het
Vmn1r173 A G 7: 23,402,260 (GRCm39) D165G probably benign Het
Xpc A G 6: 91,476,618 (GRCm39) S494P probably damaging Het
Zfp438 T A 18: 5,213,419 (GRCm39) N513I probably damaging Het
Other mutations in Dsc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Dsc3 APN 18 20,118,688 (GRCm39) missense probably null 1.00
IGL01978:Dsc3 APN 18 20,107,253 (GRCm39) missense possibly damaging 0.79
IGL02101:Dsc3 APN 18 20,134,963 (GRCm39) missense probably benign 0.01
IGL02165:Dsc3 APN 18 20,116,709 (GRCm39) missense probably benign 0.06
IGL02543:Dsc3 APN 18 20,098,885 (GRCm39) missense probably benign 0.11
IGL02970:Dsc3 APN 18 20,101,317 (GRCm39) missense probably damaging 1.00
IGL03097:Dsc3 UTSW 18 20,107,105 (GRCm39) missense probably benign 0.30
R0133:Dsc3 UTSW 18 20,104,639 (GRCm39) missense probably damaging 0.96
R0304:Dsc3 UTSW 18 20,114,298 (GRCm39) missense probably damaging 1.00
R0360:Dsc3 UTSW 18 20,104,639 (GRCm39) missense possibly damaging 0.79
R0673:Dsc3 UTSW 18 20,122,647 (GRCm39) missense probably damaging 1.00
R0826:Dsc3 UTSW 18 20,114,229 (GRCm39) missense probably damaging 0.99
R1120:Dsc3 UTSW 18 20,120,034 (GRCm39) missense probably benign 0.05
R1491:Dsc3 UTSW 18 20,120,091 (GRCm39) missense probably damaging 0.99
R1667:Dsc3 UTSW 18 20,124,617 (GRCm39) missense possibly damaging 0.58
R1688:Dsc3 UTSW 18 20,099,284 (GRCm39) missense probably damaging 1.00
R1792:Dsc3 UTSW 18 20,120,055 (GRCm39) missense probably damaging 1.00
R1858:Dsc3 UTSW 18 20,098,773 (GRCm39) missense probably damaging 0.97
R1965:Dsc3 UTSW 18 20,113,729 (GRCm39) missense probably damaging 1.00
R1988:Dsc3 UTSW 18 20,098,903 (GRCm39) missense possibly damaging 0.86
R2049:Dsc3 UTSW 18 20,122,737 (GRCm39) missense possibly damaging 0.65
R2127:Dsc3 UTSW 18 20,101,411 (GRCm39) missense probably benign 0.00
R2143:Dsc3 UTSW 18 20,113,743 (GRCm39) missense possibly damaging 0.81
R2144:Dsc3 UTSW 18 20,113,743 (GRCm39) missense possibly damaging 0.81
R2148:Dsc3 UTSW 18 20,098,695 (GRCm39) missense probably damaging 0.99
R3038:Dsc3 UTSW 18 20,124,617 (GRCm39) missense possibly damaging 0.58
R3872:Dsc3 UTSW 18 20,104,565 (GRCm39) missense probably damaging 0.99
R4229:Dsc3 UTSW 18 20,098,878 (GRCm39) missense probably damaging 1.00
R4298:Dsc3 UTSW 18 20,113,811 (GRCm39) missense possibly damaging 0.62
R4491:Dsc3 UTSW 18 20,134,922 (GRCm39) missense probably benign 0.30
R4590:Dsc3 UTSW 18 20,122,752 (GRCm39) missense probably damaging 1.00
R4615:Dsc3 UTSW 18 20,104,545 (GRCm39) missense possibly damaging 0.67
R5316:Dsc3 UTSW 18 20,096,598 (GRCm39) missense possibly damaging 0.67
R5758:Dsc3 UTSW 18 20,122,591 (GRCm39) missense probably damaging 1.00
R5796:Dsc3 UTSW 18 20,104,558 (GRCm39) missense probably benign 0.01
R5916:Dsc3 UTSW 18 20,120,077 (GRCm39) missense probably damaging 1.00
R6233:Dsc3 UTSW 18 20,098,852 (GRCm39) missense possibly damaging 0.77
R6351:Dsc3 UTSW 18 20,099,348 (GRCm39) missense probably benign 0.05
R6971:Dsc3 UTSW 18 20,099,275 (GRCm39) critical splice donor site probably null
R7261:Dsc3 UTSW 18 20,113,814 (GRCm39) nonsense probably null
R7442:Dsc3 UTSW 18 20,114,213 (GRCm39) missense probably damaging 1.00
R7795:Dsc3 UTSW 18 20,099,288 (GRCm39) missense probably damaging 1.00
R8051:Dsc3 UTSW 18 20,114,270 (GRCm39) missense probably damaging 1.00
R8531:Dsc3 UTSW 18 20,114,274 (GRCm39) missense probably damaging 1.00
R8531:Dsc3 UTSW 18 20,101,449 (GRCm39) missense probably benign
R8872:Dsc3 UTSW 18 20,122,679 (GRCm39) missense probably benign 0.02
R8927:Dsc3 UTSW 18 20,107,234 (GRCm39) missense probably benign
R8928:Dsc3 UTSW 18 20,107,234 (GRCm39) missense probably benign
R9140:Dsc3 UTSW 18 20,122,616 (GRCm39) missense probably benign 0.01
R9493:Dsc3 UTSW 18 20,122,752 (GRCm39) nonsense probably null
X0061:Dsc3 UTSW 18 20,122,684 (GRCm39) missense probably damaging 1.00
Z1177:Dsc3 UTSW 18 20,099,372 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATTCACTCCTACTAACTTCACAGG -3'
(R):5'- ACAATGCACTTGTGATTACTGC -3'

Sequencing Primer
(F):5'- TCCTACTAACTTCACAGGGATGG -3'
(R):5'- CTGCACATTTCAAATTGTGTCTG -3'
Posted On 2017-06-26