Incidental Mutation 'R6023:Atrn'
ID479023
Institutional Source Beutler Lab
Gene Symbol Atrn
Ensembl Gene ENSMUSG00000027312
Gene Nameattractin
SynonymsMgca
MMRRC Submission 044195-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6023 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location130906495-131030333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 131020980 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1327 (F1327L)
Ref Sequence ENSEMBL: ENSMUSP00000028781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028781]
Predicted Effect probably benign
Transcript: ENSMUST00000028781
AA Change: F1327L

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312
AA Change: F1327L

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 51 97 N/A INTRINSIC
EGF 99 129 9.85e-5 SMART
CUB 131 247 7.85e-18 SMART
EGF 248 282 1.47e1 SMART
Pfam:Kelch_1 339 382 1.1e-7 PFAM
Pfam:Kelch_5 389 434 2.5e-7 PFAM
Pfam:Kelch_6 390 439 3.3e-8 PFAM
Pfam:Kelch_1 553 606 8.4e-8 PFAM
PSI 646 693 7.41e-7 SMART
PSI 702 747 8.64e-8 SMART
PSI 754 799 2.11e-2 SMART
CLECT 787 918 6.14e-20 SMART
PSI 931 982 1.11e-5 SMART
PSI 985 1060 1.2e-6 SMART
EGF_Lam 1062 1105 1.97e-4 SMART
EGF_like 1108 1154 3.9e0 SMART
transmembrane domain 1278 1300 N/A INTRINSIC
low complexity region 1310 1322 N/A INTRINSIC
low complexity region 1373 1385 N/A INTRINSIC
Meta Mutation Damage Score 0.1925 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: This gene encodes a widely expressed transmembrane glycoprotein that plays important roles in diverse physiological processes such as regulation of hair pigmentation, monocyte-T cell interaction and control of energy homeostasis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the mahogany mouse phenotype of dark brown or black coat on a normally agouti background. Mice with loss-of-function mutations in this gene exhibit black coat color, tremor, adiposity, higher basal metabolic rate, juvenile-onset hypomyelination and age-dependent spongiform neurodegeneration of the central nervous system. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mutant homozygotes exhibit decreases in phaeomelanin synthesis, body weight, and adiposity; increases in locomotion, and abnormal myelination and vacuolation of the central nervous system resulting in tremors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,108,419 N1302S possibly damaging Het
Aff3 A T 1: 38,218,370 S424T probably damaging Het
Ap2b1 C T 11: 83,335,398 T207M probably damaging Het
Appl2 T C 10: 83,648,529 Q18R probably null Het
Birc6 A T 17: 74,654,377 I47F probably benign Het
Cdh23 A T 10: 60,465,542 I451N probably damaging Het
Clec3a A G 8: 114,418,143 T20A possibly damaging Het
Cpz T A 5: 35,512,578 I252F probably benign Het
Ctc1 A G 11: 69,022,607 D143G probably benign Het
Dhrs1 A T 14: 55,743,670 Y94* probably null Het
Dnajc25 A G 4: 59,013,752 K157E possibly damaging Het
Dpp6 T C 5: 27,723,547 I789T probably damaging Het
Duox1 T G 2: 122,337,684 F1097V probably benign Het
Ercc8 A G 13: 108,178,577 T242A probably damaging Het
Evc2 T A 5: 37,348,616 M93K probably benign Het
Glra1 A T 11: 55,533,853 V94E probably damaging Het
Got1l1 A T 8: 27,199,904 Y151* probably null Het
Hcrtr2 T A 9: 76,230,604 I410F probably benign Het
Ighv1-72 T A 12: 115,757,912 probably benign Het
Kel C A 6: 41,697,475 E340D probably benign Het
Kif11 A G 19: 37,390,710 E283G probably damaging Het
Klk4 T G 7: 43,884,058 F114V probably benign Het
Krt7 T C 15: 101,412,397 probably benign Het
Lrrc74a A G 12: 86,758,606 I401V probably damaging Het
Luzp2 T C 7: 55,058,067 S68P possibly damaging Het
Naip1 T C 13: 100,426,186 T824A probably benign Het
Nav3 T C 10: 109,823,515 Q747R possibly damaging Het
Olfr1212 A G 2: 88,958,715 D83G possibly damaging Het
Olfr1342 T A 4: 118,690,074 Y126F probably damaging Het
Olfr1477 A G 19: 13,502,703 D120G probably damaging Het
Olfr339 A G 2: 36,421,511 T38A probably damaging Het
Olfr566 T C 7: 102,856,962 I107V possibly damaging Het
Olfr649 T C 7: 104,189,673 H178R probably damaging Het
Olfr837 A C 9: 19,137,725 H244P probably damaging Het
Pcdhb11 T C 18: 37,422,925 I436T possibly damaging Het
Pfdn2 T C 1: 171,356,751 Y65H probably damaging Het
Polr2h T C 16: 20,719,026 Y58H probably benign Het
Prrt4 G A 6: 29,176,453 P291L probably benign Het
Psg29 G T 7: 17,210,512 V316L possibly damaging Het
Rnf112 T A 11: 61,449,729 E525V probably damaging Het
Sgms1 T C 19: 32,124,373 K411R probably benign Het
Sh3tc1 T A 5: 35,706,951 K631* probably null Het
Syne1 T C 10: 5,443,223 M48V probably benign Het
Thrb C T 14: 18,011,209 T226I probably damaging Het
Trim67 A T 8: 124,815,104 D347V probably damaging Het
Try4 T C 6: 41,303,421 S60P probably damaging Het
Ttn G T 2: 76,735,400 L19876I probably damaging Het
Vars C T 17: 35,001,609 R56C probably damaging Het
Vmn1r9 A G 6: 57,071,254 I105V probably benign Het
Vps8 C A 16: 21,461,238 T313K probably benign Het
Other mutations in Atrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Atrn APN 2 130958079 missense probably damaging 1.00
IGL00571:Atrn APN 2 130995048 missense probably damaging 1.00
IGL01092:Atrn APN 2 130947636 nonsense probably null
IGL01572:Atrn APN 2 131002795 missense probably damaging 1.00
IGL01924:Atrn APN 2 130935565 missense probably damaging 1.00
IGL02116:Atrn APN 2 130958089 missense probably damaging 1.00
IGL02372:Atrn APN 2 131002754 splice site probably benign
IGL02390:Atrn APN 2 131020977 missense possibly damaging 0.82
IGL02548:Atrn APN 2 130972282 missense probably damaging 1.00
IGL02749:Atrn APN 2 130970144 nonsense probably null
IGL02749:Atrn APN 2 130947734 splice site probably benign
BB010:Atrn UTSW 2 130995066 missense probably damaging 1.00
BB020:Atrn UTSW 2 130995066 missense probably damaging 1.00
R0026:Atrn UTSW 2 130957920 missense probably damaging 1.00
R0403:Atrn UTSW 2 130906859 missense probably damaging 1.00
R0479:Atrn UTSW 2 130999165 nonsense probably null
R0544:Atrn UTSW 2 130986826 missense probably damaging 1.00
R0570:Atrn UTSW 2 130980134 missense probably benign 0.01
R0606:Atrn UTSW 2 130906856 missense possibly damaging 0.90
R0617:Atrn UTSW 2 130995085 critical splice donor site probably null
R0658:Atrn UTSW 2 130970227 critical splice donor site probably null
R1108:Atrn UTSW 2 130957914 missense probably damaging 1.00
R1112:Atrn UTSW 2 130999161 missense probably benign 0.04
R1219:Atrn UTSW 2 131021007 missense possibly damaging 0.90
R1422:Atrn UTSW 2 130957914 missense probably damaging 1.00
R1524:Atrn UTSW 2 130957080 missense probably benign 0.15
R1653:Atrn UTSW 2 130935624 missense probably benign
R1795:Atrn UTSW 2 130972288 missense probably benign
R1807:Atrn UTSW 2 130982772 missense possibly damaging 0.94
R1920:Atrn UTSW 2 130995051 missense probably damaging 1.00
R1921:Atrn UTSW 2 130995051 missense probably damaging 1.00
R1935:Atrn UTSW 2 130958035 missense probably damaging 1.00
R1982:Atrn UTSW 2 130970222 missense probably benign
R2000:Atrn UTSW 2 130935588 missense probably damaging 1.00
R2143:Atrn UTSW 2 130957996 missense probably benign 0.03
R2336:Atrn UTSW 2 130957954 missense probably damaging 1.00
R2679:Atrn UTSW 2 130961675 critical splice donor site probably null
R3426:Atrn UTSW 2 131020956 missense probably benign 0.06
R3909:Atrn UTSW 2 130994207 missense probably damaging 1.00
R4077:Atrn UTSW 2 130964930 critical splice donor site probably null
R4162:Atrn UTSW 2 130994228 splice site probably benign
R4195:Atrn UTSW 2 130933412 missense probably damaging 1.00
R4364:Atrn UTSW 2 130970208 missense probably benign 0.39
R4465:Atrn UTSW 2 130960468 missense probably benign 0.08
R4510:Atrn UTSW 2 130935577 nonsense probably null
R4511:Atrn UTSW 2 130935577 nonsense probably null
R4527:Atrn UTSW 2 130973504 missense probably benign 0.10
R4586:Atrn UTSW 2 130982042 missense probably damaging 1.00
R4592:Atrn UTSW 2 130999130 intron probably benign
R4658:Atrn UTSW 2 130933429 missense probably damaging 1.00
R4735:Atrn UTSW 2 131020990 missense probably benign 0.06
R4960:Atrn UTSW 2 130995047 nonsense probably null
R4999:Atrn UTSW 2 130975954 missense probably damaging 1.00
R5066:Atrn UTSW 2 130994193 missense possibly damaging 0.60
R5080:Atrn UTSW 2 130970124 missense possibly damaging 0.95
R5141:Atrn UTSW 2 130999130 intron probably benign
R5256:Atrn UTSW 2 130946019 missense probably benign 0.39
R5494:Atrn UTSW 2 131023075 missense probably damaging 1.00
R5678:Atrn UTSW 2 130970016 missense probably damaging 0.96
R5752:Atrn UTSW 2 130906544 unclassified probably benign
R5931:Atrn UTSW 2 130933436 missense possibly damaging 0.56
R6176:Atrn UTSW 2 130946091 missense probably benign 0.31
R6377:Atrn UTSW 2 130979969 missense probably damaging 1.00
R6433:Atrn UTSW 2 131023027 missense probably damaging 1.00
R7226:Atrn UTSW 2 130986744 missense probably damaging 0.99
R7402:Atrn UTSW 2 130947600 missense probably damaging 1.00
R7541:Atrn UTSW 2 130961571 missense possibly damaging 0.46
R7587:Atrn UTSW 2 130980114 missense probably damaging 1.00
R7872:Atrn UTSW 2 130970227 critical splice donor site probably null
R7910:Atrn UTSW 2 130964887 missense probably benign 0.04
R7913:Atrn UTSW 2 130970211 missense probably damaging 1.00
R7933:Atrn UTSW 2 130995066 missense probably damaging 1.00
R8044:Atrn UTSW 2 130935529 missense probably damaging 1.00
R8079:Atrn UTSW 2 131013641 missense probably null 1.00
R8093:Atrn UTSW 2 130975988 missense probably benign 0.00
R8203:Atrn UTSW 2 130960549 missense probably benign 0.00
R8234:Atrn UTSW 2 131023000 critical splice acceptor site probably null
RF009:Atrn UTSW 2 130906922 missense probably benign 0.12
X0024:Atrn UTSW 2 130958139 missense probably damaging 1.00
Z1088:Atrn UTSW 2 130973399 missense probably benign
Z1176:Atrn UTSW 2 130946193 missense probably benign 0.27
Z1177:Atrn UTSW 2 130946042 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTAGCACCTTGTCATGTCCAG -3'
(R):5'- ACACAGAGCCCCTTACGGTC -3'

Sequencing Primer
(F):5'- AGTTTTCCTCAGCTGTCACAGAAG -3'
(R):5'- CTTCTGCTGACTAACTGTTAGAGAG -3'
Posted On2017-06-26