Incidental Mutation 'R6023:Kel'
ID479032
Institutional Source Beutler Lab
Gene Symbol Kel
Ensembl Gene ENSMUSG00000029866
Gene NameKell blood group
SynonymsCD238
MMRRC Submission 044195-MU
Accession Numbers

Genbank: NM_032540; MGI: 1346053

Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R6023 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location41686330-41704339 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 41697475 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 340 (E340D)
Ref Sequence ENSEMBL: ENSMUSP00000031899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031899]
Predicted Effect probably benign
Transcript: ENSMUST00000031899
AA Change: E340D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031899
Gene: ENSMUSG00000029866
AA Change: E340D

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
Pfam:Peptidase_M13_N 81 463 1.5e-68 PFAM
Pfam:Peptidase_M13 521 712 2.1e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192118
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192406
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II transmembrane glycoprotein that is the highly polymorphic Kell blood group antigen. The Kell glycoprotein links via a single disulfide bond to the XK membrane protein that carries the Kx antigen. The encoded protein contains sequence and structural similarity to members of the neprilysin (M13) family of zinc endopeptidases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased heart rate, altered hematological parameters and ECG waveform features, decreased erythrocyte Mg2+ and K+ ion content, mild motor deficits, and giant axon changes with varying degrees of paranodal demyelination in the spinal cord and sciatic nerve. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,108,419 N1302S possibly damaging Het
Aff3 A T 1: 38,218,370 S424T probably damaging Het
Ap2b1 C T 11: 83,335,398 T207M probably damaging Het
Appl2 T C 10: 83,648,529 Q18R probably null Het
Atrn T C 2: 131,020,980 F1327L probably benign Het
Birc6 A T 17: 74,654,377 I47F probably benign Het
Cdh23 A T 10: 60,465,542 I451N probably damaging Het
Clec3a A G 8: 114,418,143 T20A possibly damaging Het
Cpz T A 5: 35,512,578 I252F probably benign Het
Ctc1 A G 11: 69,022,607 D143G probably benign Het
Dhrs1 A T 14: 55,743,670 Y94* probably null Het
Dnajc25 A G 4: 59,013,752 K157E possibly damaging Het
Dpp6 T C 5: 27,723,547 I789T probably damaging Het
Duox1 T G 2: 122,337,684 F1097V probably benign Het
Ercc8 A G 13: 108,178,577 T242A probably damaging Het
Evc2 T A 5: 37,348,616 M93K probably benign Het
Glra1 A T 11: 55,533,853 V94E probably damaging Het
Got1l1 A T 8: 27,199,904 Y151* probably null Het
Hcrtr2 T A 9: 76,230,604 I410F probably benign Het
Ighv1-72 T A 12: 115,757,912 probably benign Het
Kif11 A G 19: 37,390,710 E283G probably damaging Het
Klk4 T G 7: 43,884,058 F114V probably benign Het
Krt7 T C 15: 101,412,397 probably benign Het
Lrrc74a A G 12: 86,758,606 I401V probably damaging Het
Luzp2 T C 7: 55,058,067 S68P possibly damaging Het
Naip1 T C 13: 100,426,186 T824A probably benign Het
Nav3 T C 10: 109,823,515 Q747R possibly damaging Het
Olfr1212 A G 2: 88,958,715 D83G possibly damaging Het
Olfr1342 T A 4: 118,690,074 Y126F probably damaging Het
Olfr1477 A G 19: 13,502,703 D120G probably damaging Het
Olfr339 A G 2: 36,421,511 T38A probably damaging Het
Olfr566 T C 7: 102,856,962 I107V possibly damaging Het
Olfr649 T C 7: 104,189,673 H178R probably damaging Het
Olfr837 A C 9: 19,137,725 H244P probably damaging Het
Pcdhb11 T C 18: 37,422,925 I436T possibly damaging Het
Pfdn2 T C 1: 171,356,751 Y65H probably damaging Het
Polr2h T C 16: 20,719,026 Y58H probably benign Het
Prrt4 G A 6: 29,176,453 P291L probably benign Het
Psg29 G T 7: 17,210,512 V316L possibly damaging Het
Rnf112 T A 11: 61,449,729 E525V probably damaging Het
Sgms1 T C 19: 32,124,373 K411R probably benign Het
Sh3tc1 T A 5: 35,706,951 K631* probably null Het
Syne1 T C 10: 5,443,223 M48V probably benign Het
Thrb C T 14: 18,011,209 T226I probably damaging Het
Trim67 A T 8: 124,815,104 D347V probably damaging Het
Try4 T C 6: 41,303,421 S60P probably damaging Het
Ttn G T 2: 76,735,400 L19876I probably damaging Het
Vars C T 17: 35,001,609 R56C probably damaging Het
Vmn1r9 A G 6: 57,071,254 I105V probably benign Het
Vps8 C A 16: 21,461,238 T313K probably benign Het
Other mutations in Kel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Kel APN 6 41688575 missense probably damaging 1.00
IGL00792:Kel APN 6 41702012 missense probably damaging 1.00
IGL00972:Kel APN 6 41688066 missense possibly damaging 0.62
IGL01121:Kel APN 6 41702409 missense probably benign 0.00
IGL01286:Kel APN 6 41688117 splice site probably null
IGL01461:Kel APN 6 41701911 critical splice donor site probably null
IGL01836:Kel APN 6 41697438 missense possibly damaging 0.50
IGL02037:Kel APN 6 41697474 missense probably benign 0.01
IGL02103:Kel APN 6 41702389 missense probably benign 0.18
IGL02604:Kel APN 6 41687582 missense probably damaging 0.98
IGL03102:Kel APN 6 41702983 missense probably benign 0.00
IGL03274:Kel APN 6 41687995 splice site probably null
IGL03355:Kel APN 6 41698887 critical splice donor site probably null
A4554:Kel UTSW 6 41697419 missense possibly damaging 0.95
R0121:Kel UTSW 6 41702064 unclassified probably benign
R0153:Kel UTSW 6 41701943 missense probably benign 0.08
R0535:Kel UTSW 6 41690838 missense probably null 0.21
R0658:Kel UTSW 6 41703031 missense probably damaging 1.00
R1005:Kel UTSW 6 41688617 missense probably damaging 1.00
R1199:Kel UTSW 6 41688591 missense possibly damaging 0.95
R1272:Kel UTSW 6 41703470 missense probably benign 0.00
R1531:Kel UTSW 6 41688626 missense probably damaging 0.99
R1880:Kel UTSW 6 41687545 missense possibly damaging 0.95
R2102:Kel UTSW 6 41686484 missense possibly damaging 0.86
R2118:Kel UTSW 6 41689300 missense probably benign
R2571:Kel UTSW 6 41688067 missense possibly damaging 0.62
R4209:Kel UTSW 6 41698425 nonsense probably null
R4210:Kel UTSW 6 41698425 nonsense probably null
R4260:Kel UTSW 6 41686423 utr 3 prime probably benign
R4382:Kel UTSW 6 41698400 missense probably benign 0.13
R5023:Kel UTSW 6 41688111 missense probably damaging 1.00
R5033:Kel UTSW 6 41699055 missense probably damaging 1.00
R5239:Kel UTSW 6 41688114 nonsense probably null
R5431:Kel UTSW 6 41698420 missense probably benign 0.23
R5742:Kel UTSW 6 41699027 missense probably damaging 1.00
R5745:Kel UTSW 6 41699027 missense probably damaging 1.00
R5746:Kel UTSW 6 41699027 missense probably damaging 1.00
R5978:Kel UTSW 6 41688045 missense probably benign 0.00
R6109:Kel UTSW 6 41688862 missense probably benign 0.06
R6125:Kel UTSW 6 41690786 missense probably damaging 1.00
R6319:Kel UTSW 6 41702447 missense probably benign 0.05
R6368:Kel UTSW 6 41688851 nonsense probably null
R6864:Kel UTSW 6 41703760 critical splice donor site probably null
R6956:Kel UTSW 6 41687973 missense probably damaging 1.00
R7644:Kel UTSW 6 41690808 missense probably benign 0.03
R7938:Kel UTSW 6 41698376 missense probably benign 0.06
R8028:Kel UTSW 6 41699024 missense probably benign 0.21
R8082:Kel UTSW 6 41703490 missense possibly damaging 0.94
R8465:Kel UTSW 6 41689538 critical splice donor site probably null
X0028:Kel UTSW 6 41698351 missense probably damaging 0.99
Z1176:Kel UTSW 6 41687572 missense probably damaging 1.00
Z1177:Kel UTSW 6 41689559 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTTGCCTACATCCACGGTG -3'
(R):5'- ATTCCTCTGTCACTCCCAAAAG -3'

Sequencing Primer
(F):5'- GTGTGGCACCTCTCCTCCTATG -3'
(R):5'- TCTGTCACTCCCAAAAGCCAAATC -3'
Posted On2017-06-26