Incidental Mutation 'R6023:Hcrtr2'
ID479044
Institutional Source Beutler Lab
Gene Symbol Hcrtr2
Ensembl Gene ENSMUSG00000032360
Gene Namehypocretin (orexin) receptor 2
SynonymsmOXR2, OX2r, mOX2aR, mOX2bR
MMRRC Submission 044195-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6023 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location76225880-76323856 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 76230604 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 410 (I410F)
Ref Sequence ENSEMBL: ENSMUSP00000139377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063140] [ENSMUST00000184757]
Predicted Effect probably benign
Transcript: ENSMUST00000063140
AA Change: I410F

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000058230
Gene: ENSMUSG00000032360
AA Change: I410F

DomainStartEndE-ValueType
Pfam:7tm_1 71 364 2.2e-59 PFAM
Pfam:Orexin_rec2 386 443 1.2e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184757
AA Change: I410F

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000139377
Gene: ENSMUSG00000032360
AA Change: I410F

DomainStartEndE-ValueType
Pfam:7tm_1 71 364 1.2e-59 PFAM
Pfam:Orexin_rec2 383 443 2.2e-47 PFAM
Meta Mutation Damage Score 0.0742 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G-protein coupled receptor involved in the regulation of feeding behavior. The encoded protein binds the hypothalamic neuropeptides orexin A and orexin B. A related gene (HCRTR1) encodes a G-protein coupled receptor that selectively binds orexin A. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice bearing targeted mutations in this gene exhibit fragmentation of sleep/wake states with similarity to narcolepsy and rare or very rare episodes of cataplexy. In addition, mice homozygous for a funtionally null allele display enhanced depression-likebehavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,108,419 N1302S possibly damaging Het
Aff3 A T 1: 38,218,370 S424T probably damaging Het
Ap2b1 C T 11: 83,335,398 T207M probably damaging Het
Appl2 T C 10: 83,648,529 Q18R probably null Het
Atrn T C 2: 131,020,980 F1327L probably benign Het
Birc6 A T 17: 74,654,377 I47F probably benign Het
Cdh23 A T 10: 60,465,542 I451N probably damaging Het
Clec3a A G 8: 114,418,143 T20A possibly damaging Het
Cpz T A 5: 35,512,578 I252F probably benign Het
Ctc1 A G 11: 69,022,607 D143G probably benign Het
Dhrs1 A T 14: 55,743,670 Y94* probably null Het
Dnajc25 A G 4: 59,013,752 K157E possibly damaging Het
Dpp6 T C 5: 27,723,547 I789T probably damaging Het
Duox1 T G 2: 122,337,684 F1097V probably benign Het
Ercc8 A G 13: 108,178,577 T242A probably damaging Het
Evc2 T A 5: 37,348,616 M93K probably benign Het
Glra1 A T 11: 55,533,853 V94E probably damaging Het
Got1l1 A T 8: 27,199,904 Y151* probably null Het
Ighv1-72 T A 12: 115,757,912 probably benign Het
Kel C A 6: 41,697,475 E340D probably benign Het
Kif11 A G 19: 37,390,710 E283G probably damaging Het
Klk4 T G 7: 43,884,058 F114V probably benign Het
Krt7 T C 15: 101,412,397 probably benign Het
Lrrc74a A G 12: 86,758,606 I401V probably damaging Het
Luzp2 T C 7: 55,058,067 S68P possibly damaging Het
Naip1 T C 13: 100,426,186 T824A probably benign Het
Nav3 T C 10: 109,823,515 Q747R possibly damaging Het
Olfr1212 A G 2: 88,958,715 D83G possibly damaging Het
Olfr1342 T A 4: 118,690,074 Y126F probably damaging Het
Olfr1477 A G 19: 13,502,703 D120G probably damaging Het
Olfr339 A G 2: 36,421,511 T38A probably damaging Het
Olfr566 T C 7: 102,856,962 I107V possibly damaging Het
Olfr649 T C 7: 104,189,673 H178R probably damaging Het
Olfr837 A C 9: 19,137,725 H244P probably damaging Het
Pcdhb11 T C 18: 37,422,925 I436T possibly damaging Het
Pfdn2 T C 1: 171,356,751 Y65H probably damaging Het
Polr2h T C 16: 20,719,026 Y58H probably benign Het
Prrt4 G A 6: 29,176,453 P291L probably benign Het
Psg29 G T 7: 17,210,512 V316L possibly damaging Het
Rnf112 T A 11: 61,449,729 E525V probably damaging Het
Sgms1 T C 19: 32,124,373 K411R probably benign Het
Sh3tc1 T A 5: 35,706,951 K631* probably null Het
Syne1 T C 10: 5,443,223 M48V probably benign Het
Thrb C T 14: 18,011,209 T226I probably damaging Het
Trim67 A T 8: 124,815,104 D347V probably damaging Het
Try4 T C 6: 41,303,421 S60P probably damaging Het
Ttn G T 2: 76,735,400 L19876I probably damaging Het
Vars C T 17: 35,001,609 R56C probably damaging Het
Vmn1r9 A G 6: 57,071,254 I105V probably benign Het
Vps8 C A 16: 21,461,238 T313K probably benign Het
Other mutations in Hcrtr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Hcrtr2 APN 9 76228155 missense possibly damaging 0.86
IGL00492:Hcrtr2 APN 9 76246441 missense probably damaging 1.00
IGL00782:Hcrtr2 APN 9 76230497 utr 3 prime probably benign
IGL03096:Hcrtr2 APN 9 76254626 missense probably benign 0.01
PIT4508001:Hcrtr2 UTSW 9 76246380 nonsense probably null
R0038:Hcrtr2 UTSW 9 76259681 missense probably benign 0.00
R0038:Hcrtr2 UTSW 9 76259681 missense probably benign 0.00
R0268:Hcrtr2 UTSW 9 76228188 missense probably benign
R0389:Hcrtr2 UTSW 9 76246380 nonsense probably null
R0499:Hcrtr2 UTSW 9 76254672 missense probably damaging 1.00
R0607:Hcrtr2 UTSW 9 76230684 missense probably benign 0.00
R1622:Hcrtr2 UTSW 9 76323440 missense probably benign 0.03
R1637:Hcrtr2 UTSW 9 76232999 missense probably benign
R1698:Hcrtr2 UTSW 9 76246453 missense probably damaging 1.00
R1856:Hcrtr2 UTSW 9 76259785 missense probably damaging 1.00
R1876:Hcrtr2 UTSW 9 76246345 critical splice donor site probably null
R3411:Hcrtr2 UTSW 9 76233008 missense probably benign 0.30
R4469:Hcrtr2 UTSW 9 76230556 missense probably benign 0.30
R4560:Hcrtr2 UTSW 9 76254688 missense probably damaging 1.00
R4797:Hcrtr2 UTSW 9 76254534 missense probably damaging 1.00
R5001:Hcrtr2 UTSW 9 76230604 missense probably benign 0.00
R5027:Hcrtr2 UTSW 9 76323296 missense probably benign 0.31
R5611:Hcrtr2 UTSW 9 76323314 missense probably damaging 0.98
R5770:Hcrtr2 UTSW 9 76259666 missense probably damaging 0.98
R5826:Hcrtr2 UTSW 9 76323287 missense probably benign 0.32
R6110:Hcrtr2 UTSW 9 76259782 missense probably damaging 1.00
R7084:Hcrtr2 UTSW 9 76230660 missense probably benign 0.21
R7103:Hcrtr2 UTSW 9 76254511 missense probably benign 0.00
R7173:Hcrtr2 UTSW 9 76259731 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGATACTAAAACTGTTCACAGAG -3'
(R):5'- GTTAGCTTGGCTCAAGGGAACG -3'

Sequencing Primer
(F):5'- AGTCGGGTATCCTCATCA -3'
(R):5'- TCAAGGGAACGCCTCATTTG -3'
Posted On2017-06-26