Mutagenetix > Incidental Mutation

Incidental Mutation 'R6023:Ap2b1'

479052

Institutional Source

Beutler Lab

Gene Symbol

Ap2b1

Ensembl Gene

ENSMUSG00000035152

Gene Name

adaptor-related protein complex 2, beta 1 subunit

Synonyms

1300012O03Rik

MMRRC Submission

044195-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6023 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

83299024-83405035 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 83335398 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 207 (T207M)

Ref Sequence

ENSEMBL: ENSMUSP00000135445 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018875] [ENSMUST00000065692] [ENSMUST00000176430] [ENSMUST00000176523] [ENSMUST00000176944]

AlphaFold

Q9DBG3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000018875
AA Change: T245M

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000018875
Gene: ENSMUSG00000035152
AA Change: T245M

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	2.6e-173	PFAM
Pfam:HEAT_2	88	157	3.7e-8	PFAM
Pfam:Cnd1	99	268	2.1e-40	PFAM
Pfam:HEAT_2	124	219	1.4e-9	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	654	675	N/A	INTRINSIC
Alpha_adaptinC2	721	831	2.94e-18	SMART
B2-adapt-app_C	840	950	9.93e-56	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000065692
AA Change: T245M

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000070714
Gene: ENSMUSG00000035152
AA Change: T245M

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	4.2e-173	PFAM
Pfam:HEAT_2	88	157	2.7e-8	PFAM
Pfam:Cnd1	99	268	1.5e-37	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	653	665	N/A	INTRINSIC
Alpha_adaptinC2	707	817	2.94e-18	SMART
B2-adapt-app_C	826	936	9.93e-56	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132178

Predicted Effect

possibly damaging
Transcript: ENSMUST00000176430
AA Change: T245M

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000134779
Gene: ENSMUSG00000035152
AA Change: T245M

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	4e-173	PFAM
Pfam:HEAT_2	88	157	2.8e-8	PFAM
Pfam:Cnd1	99	268	1.5e-37	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	654	675	N/A	INTRINSIC
Alpha_adaptinC2	721	831	2.94e-18	SMART
B2-adapt-app_C	840	936	7.22e-35	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000176523
AA Change: T207M

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000135445
Gene: ENSMUSG00000035152
AA Change: T207M

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	95	1.1e-26	PFAM
Pfam:Cnd1	69	230	1.5e-26	PFAM
Pfam:HEAT_2	85	182	5.1e-9	PFAM
Pfam:Adaptin_N	90	496	4e-125	PFAM
low complexity region	587	605	N/A	INTRINSIC
low complexity region	616	637	N/A	INTRINSIC
Alpha_adaptinC2	683	793	2.94e-18	SMART
B2-adapt-app_C	802	912	9.93e-56	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000176944

SMART Domains

Protein: ENSMUSP00000134798
Gene: ENSMUSG00000035152

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	199	3.4e-67	PFAM
Pfam:DNA_alkylation	18	196	4.6e-8	PFAM
Pfam:HEAT_2	88	185	3.1e-13	PFAM
Pfam:Cnd1	99	198	4.2e-27	PFAM
Pfam:HEAT	122	151	1.4e-5	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.3%

Validation Efficiency

100% (51/51)

MGI Phenotype

PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc8	T	C	7: 46,108,419	N1302S	possibly damaging	Het
Aff3	A	T	1: 38,218,370	S424T	probably damaging	Het
Appl2	T	C	10: 83,648,529	Q18R	probably null	Het
Atrn	T	C	2: 131,020,980	F1327L	probably benign	Het
Birc6	A	T	17: 74,654,377	I47F	probably benign	Het
Cdh23	A	T	10: 60,465,542	I451N	probably damaging	Het
Clec3a	A	G	8: 114,418,143	T20A	possibly damaging	Het
Cpz	T	A	5: 35,512,578	I252F	probably benign	Het
Ctc1	A	G	11: 69,022,607	D143G	probably benign	Het
Dhrs1	A	T	14: 55,743,670	Y94*	probably null	Het
Dnajc25	A	G	4: 59,013,752	K157E	possibly damaging	Het
Dpp6	T	C	5: 27,723,547	I789T	probably damaging	Het
Duox1	T	G	2: 122,337,684	F1097V	probably benign	Het
Ercc8	A	G	13: 108,178,577	T242A	probably damaging	Het
Evc2	T	A	5: 37,348,616	M93K	probably benign	Het
Glra1	A	T	11: 55,533,853	V94E	probably damaging	Het
Got1l1	A	T	8: 27,199,904	Y151*	probably null	Het
Hcrtr2	T	A	9: 76,230,604	I410F	probably benign	Het
Ighv1-72	T	A	12: 115,757,912		probably benign	Het
Kel	C	A	6: 41,697,475	E340D	probably benign	Het
Kif11	A	G	19: 37,390,710	E283G	probably damaging	Het
Klk4	T	G	7: 43,884,058	F114V	probably benign	Het
Krt7	T	C	15: 101,412,397		probably benign	Het
Lrrc74a	A	G	12: 86,758,606	I401V	probably damaging	Het
Luzp2	T	C	7: 55,058,067	S68P	possibly damaging	Het
Naip1	T	C	13: 100,426,186	T824A	probably benign	Het
Nav3	T	C	10: 109,823,515	Q747R	possibly damaging	Het
Olfr1212	A	G	2: 88,958,715	D83G	possibly damaging	Het
Olfr1342	T	A	4: 118,690,074	Y126F	probably damaging	Het
Olfr1477	A	G	19: 13,502,703	D120G	probably damaging	Het
Olfr339	A	G	2: 36,421,511	T38A	probably damaging	Het
Olfr566	T	C	7: 102,856,962	I107V	possibly damaging	Het
Olfr649	T	C	7: 104,189,673	H178R	probably damaging	Het
Olfr837	A	C	9: 19,137,725	H244P	probably damaging	Het
Pcdhb11	T	C	18: 37,422,925	I436T	possibly damaging	Het
Pfdn2	T	C	1: 171,356,751	Y65H	probably damaging	Het
Polr2h	T	C	16: 20,719,026	Y58H	probably benign	Het
Prrt4	G	A	6: 29,176,453	P291L	probably benign	Het
Psg29	G	T	7: 17,210,512	V316L	possibly damaging	Het
Rnf112	T	A	11: 61,449,729	E525V	probably damaging	Het
Sgms1	T	C	19: 32,124,373	K411R	probably benign	Het
Sh3tc1	T	A	5: 35,706,951	K631*	probably null	Het
Syne1	T	C	10: 5,443,223	M48V	probably benign	Het
Thrb	C	T	14: 18,011,209	T226I	probably damaging	Het
Trim67	A	T	8: 124,815,104	D347V	probably damaging	Het
Try4	T	C	6: 41,303,421	S60P	probably damaging	Het
Ttn	G	T	2: 76,735,400	L19876I	probably damaging	Het
Vars	C	T	17: 35,001,609	R56C	probably damaging	Het
Vmn1r9	A	G	6: 57,071,254	I105V	probably benign	Het
Vps8	C	A	16: 21,461,238	T313K	probably benign	Het

Other mutations in Ap2b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00864:Ap2b1	APN	11	83333158	missense	probably damaging	0.99
IGL01583:Ap2b1	APN	11	83324611	missense	possibly damaging	0.61
IGL01753:Ap2b1	APN	11	83321973	missense	probably damaging	1.00
IGL01992:Ap2b1	APN	11	83335530	missense	probably damaging	1.00
IGL02192:Ap2b1	APN	11	83346766	missense	possibly damaging	0.48
IGL02315:Ap2b1	APN	11	83336799	missense	probably damaging	0.96
IGL03235:Ap2b1	APN	11	83341384	missense	probably benign	0.41
P0045:Ap2b1	UTSW	11	83368026	missense	probably damaging	1.00
R0121:Ap2b1	UTSW	11	83321967	missense	possibly damaging	0.66
R0334:Ap2b1	UTSW	11	83367874	splice site	probably benign
R1222:Ap2b1	UTSW	11	83346738	missense	probably benign	0.06
R1297:Ap2b1	UTSW	11	83333109	missense	probably damaging	1.00
R1653:Ap2b1	UTSW	11	83346831	missense	probably damaging	1.00
R1719:Ap2b1	UTSW	11	83324604	missense	probably damaging	1.00
R1885:Ap2b1	UTSW	11	83390735	missense	probably damaging	0.99
R1886:Ap2b1	UTSW	11	83390735	missense	probably damaging	0.99
R1965:Ap2b1	UTSW	11	83346895	missense	probably benign	0.00
R1966:Ap2b1	UTSW	11	83346895	missense	probably benign	0.00
R2046:Ap2b1	UTSW	11	83336386	missense	probably benign	0.14
R2086:Ap2b1	UTSW	11	83351118	missense	possibly damaging	0.88
R2132:Ap2b1	UTSW	11	83324761	splice site	probably benign
R3615:Ap2b1	UTSW	11	83324565	missense	possibly damaging	0.84
R3616:Ap2b1	UTSW	11	83324565	missense	possibly damaging	0.84
R3983:Ap2b1	UTSW	11	83390716	missense	probably damaging	1.00
R4124:Ap2b1	UTSW	11	83365645	critical splice acceptor site	probably null
R4125:Ap2b1	UTSW	11	83365645	critical splice acceptor site	probably null
R4198:Ap2b1	UTSW	11	83342603	missense	probably damaging	1.00
R4202:Ap2b1	UTSW	11	83335604	critical splice donor site	probably null
R4543:Ap2b1	UTSW	11	83324650	missense	probably damaging	1.00
R4583:Ap2b1	UTSW	11	83397779	missense	probably benign	0.00
R4589:Ap2b1	UTSW	11	83333011	nonsense	probably null
R4916:Ap2b1	UTSW	11	83390706	missense	probably damaging	1.00
R5005:Ap2b1	UTSW	11	83339392	missense	probably damaging	1.00
R5385:Ap2b1	UTSW	11	83342601	missense	probably damaging	1.00
R5510:Ap2b1	UTSW	11	83336737	splice site	probably null
R5738:Ap2b1	UTSW	11	83336430	splice site	probably null
R6269:Ap2b1	UTSW	11	83346673	missense	probably damaging	1.00
R6383:Ap2b1	UTSW	11	83346825	missense	probably damaging	1.00
R6416:Ap2b1	UTSW	11	83308239	start codon destroyed	probably null	1.00
R6502:Ap2b1	UTSW	11	83342679	missense	probably damaging	0.97
R6810:Ap2b1	UTSW	11	83335491	missense	possibly damaging	0.89
R6969:Ap2b1	UTSW	11	83389726	missense	probably damaging	0.99
R7238:Ap2b1	UTSW	11	83333122	missense	possibly damaging	0.91
R7241:Ap2b1	UTSW	11	83351105	missense	probably benign	0.16
R7429:Ap2b1	UTSW	11	83367998	missense	probably benign	0.00
R7588:Ap2b1	UTSW	11	83324522	missense	probably benign	0.00
R7635:Ap2b1	UTSW	11	83389728	missense	probably benign	0.09
R7651:Ap2b1	UTSW	11	83339430	critical splice donor site	probably null
R7753:Ap2b1	UTSW	11	83367907	nonsense	probably null
R8468:Ap2b1	UTSW	11	83351065	missense	probably damaging	1.00
R8943:Ap2b1	UTSW	11	83346753	missense	probably damaging	1.00
R9093:Ap2b1	UTSW	11	83324569	missense	probably damaging	1.00
R9621:Ap2b1	UTSW	11	83402598	missense	probably damaging	1.00
X0064:Ap2b1	UTSW	11	83324569	missense	probably damaging	1.00
Z1177:Ap2b1	UTSW	11	83365753	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTGCCTGTAGTTTGCTGAGC -3'
(R):5'- TTGATGTTCCTCAGGGCGAC -3'

Sequencing Primer
(F):5'- CTTCTGCAGGGTTGGATCC -3'
(R):5'- TCAGGGCGACGTACTGTACTTC -3'

Posted On

2017-06-26