Incidental Mutation 'R6023:Olfr1477'
ID479063
Institutional Source Beutler Lab
Gene Symbol Olfr1477
Ensembl Gene ENSMUSG00000071629
Gene Nameolfactory receptor 1477
SynonymsMOR202-10, GA_x6K02T2RE5P-3834960-3835907
MMRRC Submission 044195-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6023 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location13500546-13506192 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13502703 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 120 (D120G)
Ref Sequence ENSEMBL: ENSMUSP00000149565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096201] [ENSMUST00000214274] [ENSMUST00000217001]
Predicted Effect probably damaging
Transcript: ENSMUST00000096201
AA Change: D120G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093915
Gene: ENSMUSG00000095189
AA Change: D120G

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 3.9e-53 PFAM
Pfam:7TM_GPCR_Srsx 34 304 2.6e-6 PFAM
Pfam:7tm_1 40 289 1.2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208393
Predicted Effect probably damaging
Transcript: ENSMUST00000214274
AA Change: D120G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217001
AA Change: D120G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.3538 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,108,419 N1302S possibly damaging Het
Aff3 A T 1: 38,218,370 S424T probably damaging Het
Ap2b1 C T 11: 83,335,398 T207M probably damaging Het
Appl2 T C 10: 83,648,529 Q18R probably null Het
Atrn T C 2: 131,020,980 F1327L probably benign Het
Birc6 A T 17: 74,654,377 I47F probably benign Het
Cdh23 A T 10: 60,465,542 I451N probably damaging Het
Clec3a A G 8: 114,418,143 T20A possibly damaging Het
Cpz T A 5: 35,512,578 I252F probably benign Het
Ctc1 A G 11: 69,022,607 D143G probably benign Het
Dhrs1 A T 14: 55,743,670 Y94* probably null Het
Dnajc25 A G 4: 59,013,752 K157E possibly damaging Het
Dpp6 T C 5: 27,723,547 I789T probably damaging Het
Duox1 T G 2: 122,337,684 F1097V probably benign Het
Ercc8 A G 13: 108,178,577 T242A probably damaging Het
Evc2 T A 5: 37,348,616 M93K probably benign Het
Glra1 A T 11: 55,533,853 V94E probably damaging Het
Got1l1 A T 8: 27,199,904 Y151* probably null Het
Hcrtr2 T A 9: 76,230,604 I410F probably benign Het
Ighv1-72 T A 12: 115,757,912 probably benign Het
Kel C A 6: 41,697,475 E340D probably benign Het
Kif11 A G 19: 37,390,710 E283G probably damaging Het
Klk4 T G 7: 43,884,058 F114V probably benign Het
Krt7 T C 15: 101,412,397 probably benign Het
Lrrc74a A G 12: 86,758,606 I401V probably damaging Het
Luzp2 T C 7: 55,058,067 S68P possibly damaging Het
Naip1 T C 13: 100,426,186 T824A probably benign Het
Nav3 T C 10: 109,823,515 Q747R possibly damaging Het
Olfr1212 A G 2: 88,958,715 D83G possibly damaging Het
Olfr1342 T A 4: 118,690,074 Y126F probably damaging Het
Olfr339 A G 2: 36,421,511 T38A probably damaging Het
Olfr566 T C 7: 102,856,962 I107V possibly damaging Het
Olfr649 T C 7: 104,189,673 H178R probably damaging Het
Olfr837 A C 9: 19,137,725 H244P probably damaging Het
Pcdhb11 T C 18: 37,422,925 I436T possibly damaging Het
Pfdn2 T C 1: 171,356,751 Y65H probably damaging Het
Polr2h T C 16: 20,719,026 Y58H probably benign Het
Prrt4 G A 6: 29,176,453 P291L probably benign Het
Psg29 G T 7: 17,210,512 V316L possibly damaging Het
Rnf112 T A 11: 61,449,729 E525V probably damaging Het
Sgms1 T C 19: 32,124,373 K411R probably benign Het
Sh3tc1 T A 5: 35,706,951 K631* probably null Het
Syne1 T C 10: 5,443,223 M48V probably benign Het
Thrb C T 14: 18,011,209 T226I probably damaging Het
Trim67 A T 8: 124,815,104 D347V probably damaging Het
Try4 T C 6: 41,303,421 S60P probably damaging Het
Ttn G T 2: 76,735,400 L19876I probably damaging Het
Vars C T 17: 35,001,609 R56C probably damaging Het
Vmn1r9 A G 6: 57,071,254 I105V probably benign Het
Vps8 C A 16: 21,461,238 T313K probably benign Het
Other mutations in Olfr1477
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01926:Olfr1477 APN 19 13502741 missense possibly damaging 0.55
IGL02394:Olfr1477 APN 19 13502864 missense probably damaging 0.97
R0047:Olfr1477 UTSW 19 13502589 missense probably benign 0.30
R0047:Olfr1477 UTSW 19 13502589 missense probably benign 0.30
R0356:Olfr1477 UTSW 19 13503077 missense possibly damaging 0.74
R0617:Olfr1477 UTSW 19 13502536 missense probably damaging 1.00
R1589:Olfr1477 UTSW 19 13502757 missense probably benign 0.03
R1725:Olfr1477 UTSW 19 13502519 missense probably damaging 1.00
R2153:Olfr1477 UTSW 19 13502488 missense probably damaging 1.00
R2362:Olfr1477 UTSW 19 13502508 missense probably damaging 1.00
R3402:Olfr1477 UTSW 19 13502948 missense probably benign 0.11
R4513:Olfr1477 UTSW 19 13502622 missense probably benign 0.05
R5197:Olfr1477 UTSW 19 13502384 missense possibly damaging 0.68
R5205:Olfr1477 UTSW 19 13502799 missense probably damaging 1.00
R5511:Olfr1477 UTSW 19 13503192 missense probably benign 0.12
R5838:Olfr1477 UTSW 19 13502558 missense probably damaging 1.00
R6232:Olfr1477 UTSW 19 13503063 missense probably damaging 1.00
R6700:Olfr1477 UTSW 19 13502813 missense probably damaging 0.97
R6769:Olfr1477 UTSW 19 13502954 missense possibly damaging 0.83
R6771:Olfr1477 UTSW 19 13502954 missense possibly damaging 0.83
R7002:Olfr1477 UTSW 19 13502675 missense probably benign 0.00
R7057:Olfr1477 UTSW 19 13502879 missense probably damaging 1.00
R7320:Olfr1477 UTSW 19 13503180 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGCTGATTCTGCTGGACTCC -3'
(R):5'- TTGTGCGAATACTGGAGCAAG -3'

Sequencing Primer
(F):5'- TGGACTCCAGACTCCACACTC -3'
(R):5'- TACTGGAGCAAGAAACAGCTAATAG -3'
Posted On2017-06-26