Incidental Mutation 'R6023:Kif11'
ID479065
Institutional Source Beutler Lab
Gene Symbol Kif11
Ensembl Gene ENSMUSG00000012443
Gene Namekinesin family member 11
SynonymsEg5, Knsl1, Kifl1
MMRRC Submission 044195-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6023 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location37376403-37421859 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37390710 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 283 (E283G)
Ref Sequence ENSEMBL: ENSMUSP00000012587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012587]
Predicted Effect probably damaging
Transcript: ENSMUST00000012587
AA Change: E283G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000012587
Gene: ENSMUSG00000012443
AA Change: E283G

DomainStartEndE-ValueType
KISc 15 366 8.21e-180 SMART
Blast:KISc 372 417 1e-16 BLAST
low complexity region 453 465 N/A INTRINSIC
Pfam:Microtub_bind 915 1049 1.2e-44 PFAM
Meta Mutation Damage Score 0.9305 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a motor protein that belongs to the kinesin-like protein family. Members of this protein family are known to be involved in various kinds of spindle dynamics. The function of this gene product includes chromosome positioning, centrosome separation and establishing a bipolar spindle during cell mitosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Deletion of Kif11 results in early embryonic lethality of homozygotes, with developmental growth arrest at E3.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,108,419 N1302S possibly damaging Het
Aff3 A T 1: 38,218,370 S424T probably damaging Het
Ap2b1 C T 11: 83,335,398 T207M probably damaging Het
Appl2 T C 10: 83,648,529 Q18R probably null Het
Atrn T C 2: 131,020,980 F1327L probably benign Het
Birc6 A T 17: 74,654,377 I47F probably benign Het
Cdh23 A T 10: 60,465,542 I451N probably damaging Het
Clec3a A G 8: 114,418,143 T20A possibly damaging Het
Cpz T A 5: 35,512,578 I252F probably benign Het
Ctc1 A G 11: 69,022,607 D143G probably benign Het
Dhrs1 A T 14: 55,743,670 Y94* probably null Het
Dnajc25 A G 4: 59,013,752 K157E possibly damaging Het
Dpp6 T C 5: 27,723,547 I789T probably damaging Het
Duox1 T G 2: 122,337,684 F1097V probably benign Het
Ercc8 A G 13: 108,178,577 T242A probably damaging Het
Evc2 T A 5: 37,348,616 M93K probably benign Het
Glra1 A T 11: 55,533,853 V94E probably damaging Het
Got1l1 A T 8: 27,199,904 Y151* probably null Het
Hcrtr2 T A 9: 76,230,604 I410F probably benign Het
Ighv1-72 T A 12: 115,757,912 probably benign Het
Kel C A 6: 41,697,475 E340D probably benign Het
Klk4 T G 7: 43,884,058 F114V probably benign Het
Krt7 T C 15: 101,412,397 probably benign Het
Lrrc74a A G 12: 86,758,606 I401V probably damaging Het
Luzp2 T C 7: 55,058,067 S68P possibly damaging Het
Naip1 T C 13: 100,426,186 T824A probably benign Het
Nav3 T C 10: 109,823,515 Q747R possibly damaging Het
Olfr1212 A G 2: 88,958,715 D83G possibly damaging Het
Olfr1342 T A 4: 118,690,074 Y126F probably damaging Het
Olfr1477 A G 19: 13,502,703 D120G probably damaging Het
Olfr339 A G 2: 36,421,511 T38A probably damaging Het
Olfr566 T C 7: 102,856,962 I107V possibly damaging Het
Olfr649 T C 7: 104,189,673 H178R probably damaging Het
Olfr837 A C 9: 19,137,725 H244P probably damaging Het
Pcdhb11 T C 18: 37,422,925 I436T possibly damaging Het
Pfdn2 T C 1: 171,356,751 Y65H probably damaging Het
Polr2h T C 16: 20,719,026 Y58H probably benign Het
Prrt4 G A 6: 29,176,453 P291L probably benign Het
Psg29 G T 7: 17,210,512 V316L possibly damaging Het
Rnf112 T A 11: 61,449,729 E525V probably damaging Het
Sgms1 T C 19: 32,124,373 K411R probably benign Het
Sh3tc1 T A 5: 35,706,951 K631* probably null Het
Syne1 T C 10: 5,443,223 M48V probably benign Het
Thrb C T 14: 18,011,209 T226I probably damaging Het
Trim67 A T 8: 124,815,104 D347V probably damaging Het
Try4 T C 6: 41,303,421 S60P probably damaging Het
Ttn G T 2: 76,735,400 L19876I probably damaging Het
Vars C T 17: 35,001,609 R56C probably damaging Het
Vmn1r9 A G 6: 57,071,254 I105V probably benign Het
Vps8 C A 16: 21,461,238 T313K probably benign Het
Other mutations in Kif11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Kif11 APN 19 37411409 missense possibly damaging 0.82
IGL00785:Kif11 APN 19 37404297 missense probably benign 0.01
IGL00785:Kif11 APN 19 37404298 missense probably damaging 0.99
IGL01586:Kif11 APN 19 37384233 splice site probably benign
IGL01883:Kif11 APN 19 37384343 missense probably benign 0.01
IGL02138:Kif11 APN 19 37384609 missense probably damaging 1.00
IGL03197:Kif11 APN 19 37407027 missense probably benign 0.00
PIT4151001:Kif11 UTSW 19 37384597 missense probably damaging 1.00
R0027:Kif11 UTSW 19 37406983 splice site probably benign
R0027:Kif11 UTSW 19 37406983 splice site probably benign
R0104:Kif11 UTSW 19 37413215 missense probably benign 0.00
R0254:Kif11 UTSW 19 37411509 missense probably benign 0.00
R0631:Kif11 UTSW 19 37413117 splice site probably benign
R1607:Kif11 UTSW 19 37387200 nonsense probably null
R1895:Kif11 UTSW 19 37387399 missense probably damaging 1.00
R1983:Kif11 UTSW 19 37390776 missense possibly damaging 0.78
R2056:Kif11 UTSW 19 37402212 missense probably benign 0.17
R2158:Kif11 UTSW 19 37410614 missense probably benign
R2291:Kif11 UTSW 19 37407003 missense probably benign
R2300:Kif11 UTSW 19 37411539 missense probably benign 0.01
R2850:Kif11 UTSW 19 37409493 missense probably benign
R2904:Kif11 UTSW 19 37403655 splice site probably benign
R3035:Kif11 UTSW 19 37407053 missense possibly damaging 0.92
R3908:Kif11 UTSW 19 37390721 missense probably damaging 1.00
R4319:Kif11 UTSW 19 37384585 missense probably damaging 0.99
R4356:Kif11 UTSW 19 37411435 missense probably benign 0.00
R4469:Kif11 UTSW 19 37416492 missense probably benign 0.05
R4623:Kif11 UTSW 19 37409747 missense probably benign
R4779:Kif11 UTSW 19 37417949 missense probably benign 0.00
R4911:Kif11 UTSW 19 37417937 missense probably benign 0.00
R4980:Kif11 UTSW 19 37387371 nonsense probably null
R5109:Kif11 UTSW 19 37384615 missense possibly damaging 0.81
R5770:Kif11 UTSW 19 37390865 missense probably benign 0.03
R6666:Kif11 UTSW 19 37409766 missense probably benign
R6755:Kif11 UTSW 19 37409751 missense probably benign 0.01
R6845:Kif11 UTSW 19 37404117 missense probably damaging 1.00
R7052:Kif11 UTSW 19 37384592 nonsense probably null
R7367:Kif11 UTSW 19 37420341 missense probably benign
R7387:Kif11 UTSW 19 37409756 missense probably damaging 1.00
R7485:Kif11 UTSW 19 37410624 missense possibly damaging 0.94
R7502:Kif11 UTSW 19 37409807 missense possibly damaging 0.53
R7591:Kif11 UTSW 19 37384263 missense probably damaging 1.00
R7618:Kif11 UTSW 19 37411560 missense probably benign 0.32
R7809:Kif11 UTSW 19 37384609 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAACTAGCTTTGAAGTGGGAG -3'
(R):5'- TGCATTTTCTCAAAGGGCTTACC -3'

Sequencing Primer
(F):5'- CTTTGAAGTGGGAGAAGGAATTTG -3'
(R):5'- GGCTTACCTCAAGATTGAAAGATGC -3'
Posted On2017-06-26