Incidental Mutation 'R6024:Creb3l4'
ID479075
Institutional Source Beutler Lab
Gene Symbol Creb3l4
Ensembl Gene ENSMUSG00000027938
Gene NamecAMP responsive element binding protein 3-like 4
SynonymsTisp40alpha, JAL, Tisp40beta, Tisp40, 1700012K17Rik, 5330432F22Rik, mJAL, ATCE1
MMRRC Submission 044196-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.760) question?
Stock #R6024 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location90237500-90243512 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 90238699 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 206 (S206L)
Ref Sequence ENSEMBL: ENSMUSP00000102992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029546] [ENSMUST00000029547] [ENSMUST00000107369] [ENSMUST00000119304]
Predicted Effect probably benign
Transcript: ENSMUST00000029546
SMART Domains Protein: ENSMUSP00000029546
Gene: ENSMUSG00000027937

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:JTB 37 143 5.6e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000029547
AA Change: S206L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029547
Gene: ENSMUSG00000027938
AA Change: S206L

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
BRLZ 191 255 1.49e-13 SMART
low complexity region 275 291 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107369
AA Change: S206L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102992
Gene: ENSMUSG00000027938
AA Change: S206L

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
BRLZ 191 255 1.49e-13 SMART
low complexity region 275 291 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119304
SMART Domains Protein: ENSMUSP00000113763
Gene: ENSMUSG00000027937

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:JTB 30 95 1.2e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157045
Meta Mutation Damage Score 0.5989 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: This gene encodes a CREB (cyclic AMP-responsive element-binding) protein with a transmembrane domain which localizes it to the ER membrane. The encoded protein may play a role in adiposity and male germ cell development. Homozygous knockout mice for this gene show increased adipogenesis, elevated testicular germ cell apoptosis and defects in spermatogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous null mice display oligozoospermia but have normal fertility and sperm morphology and motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A G 13: 81,476,505 F3782L probably benign Het
Akr1d1 T C 6: 37,558,482 I267T probably benign Het
Arhgef5 T C 6: 43,275,134 S940P probably benign Het
Art2b A G 7: 101,580,380 I104T probably benign Het
Avpr1a A G 10: 122,449,148 Y115C probably damaging Het
Ccdc84 T C 9: 44,417,952 T13A possibly damaging Het
Cdc42bpg T A 19: 6,317,496 L995Q probably damaging Het
Clip1 T C 5: 123,615,089 K210E possibly damaging Het
Cog4 C T 8: 110,881,480 T735I probably damaging Het
Csf3r C A 4: 126,037,517 probably null Het
Dnah11 G T 12: 118,030,272 S2346R probably benign Het
Dnaic2 A T 11: 114,752,908 I467F possibly damaging Het
Doxl2 A T 6: 48,976,096 K318N possibly damaging Het
Dpy19l4 A T 4: 11,276,876 M523K probably damaging Het
Ebf3 T C 7: 137,200,535 D407G probably damaging Het
Fbn2 A G 18: 58,076,836 I991T probably benign Het
Gcc1 T C 6: 28,419,300 T345A probably benign Het
Gm1527 C T 3: 28,920,603 H522Y probably benign Het
Gm340 C A 19: 41,583,957 P384T possibly damaging Het
Gm4846 T A 1: 166,490,127 Y240F probably benign Het
Hmgcl T C 4: 135,955,615 V126A probably benign Het
Ifit1bl2 G T 19: 34,620,038 S59R probably benign Het
Itga6 A G 2: 71,787,233 N32S probably benign Het
Macc1 T C 12: 119,450,425 S779P probably benign Het
Mctp1 G T 13: 76,385,161 L209F probably damaging Het
Mink1 A G 11: 70,599,089 N97S possibly damaging Het
Mst1r T A 9: 107,908,151 V336E probably benign Het
Muc16 A T 9: 18,646,671 S2775R unknown Het
Muc6 T A 7: 141,641,574 T1316S possibly damaging Het
Myh11 T A 16: 14,277,703 N65I probably damaging Het
Myo9a A G 9: 59,855,388 N801D possibly damaging Het
Nkain2 A T 10: 31,951,285 M103K probably damaging Het
Nkx2-2 T A 2: 147,184,041 Y259F probably benign Het
Nrxn1 T C 17: 90,590,098 M877V possibly damaging Het
Nxf1 C T 19: 8,767,744 L453F probably damaging Het
Pcnt T C 10: 76,420,037 S790G possibly damaging Het
Phf3 T C 1: 30,863,226 D2G probably damaging Het
Phrf1 T C 7: 141,258,985 probably benign Het
Ptpn3 C A 4: 57,248,653 probably null Het
Pygl T C 12: 70,197,067 T625A probably benign Het
R3hdm2 T A 10: 127,459,480 F239I probably damaging Het
Sesn1 A T 10: 41,896,200 I242F probably damaging Het
Shank2 C T 7: 144,180,031 T105I probably benign Het
Skint3 T C 4: 112,290,346 F350S possibly damaging Het
Slco5a1 T C 1: 12,944,070 Y320C probably damaging Het
Syt11 A G 3: 88,762,109 S159P probably benign Het
Tanc2 G A 11: 105,867,717 R768Q probably damaging Het
Tanc2 T C 11: 105,923,672 S1981P probably damaging Het
Tmem200c A C 17: 68,841,727 D435A possibly damaging Het
Trappc8 A G 18: 20,833,009 V1125A probably damaging Het
Ttn A G 2: 76,814,143 V4762A possibly damaging Het
Unc5d A G 8: 28,875,511 S149P possibly damaging Het
Usf3 A T 16: 44,219,840 N1561I probably damaging Het
Wdr4 A T 17: 31,501,298 probably benign Het
Wdr49 T G 3: 75,301,826 E612D probably benign Het
Other mutations in Creb3l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Creb3l4 APN 3 90241987 missense possibly damaging 0.95
IGL01015:Creb3l4 APN 3 90242831 start codon destroyed probably null
IGL01092:Creb3l4 APN 3 90237738 missense probably damaging 1.00
IGL02172:Creb3l4 APN 3 90242775 missense probably benign 0.21
IGL02291:Creb3l4 APN 3 90241983 missense probably benign 0.03
R1344:Creb3l4 UTSW 3 90238738 missense possibly damaging 0.73
R1418:Creb3l4 UTSW 3 90238738 missense possibly damaging 0.73
R1836:Creb3l4 UTSW 3 90238903 missense probably benign 0.26
R2154:Creb3l4 UTSW 3 90238485 missense probably damaging 1.00
R2877:Creb3l4 UTSW 3 90242308 missense probably damaging 0.99
R4923:Creb3l4 UTSW 3 90242214 missense probably benign 0.00
R6683:Creb3l4 UTSW 3 90237805 missense probably benign 0.08
R7567:Creb3l4 UTSW 3 90242422 missense probably benign 0.00
Z1088:Creb3l4 UTSW 3 90237751 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGTAGTTTCTGATTCTGTTCCGAAC -3'
(R):5'- CAACTGCTGGCACAAGAAGG -3'

Sequencing Primer
(F):5'- GAACAGGCCGCCACTCTAG -3'
(R):5'- AGAAGGGATTACTCTGCCCTC -3'
Posted On2017-06-26