Incidental Mutation 'R6024:Hmgcl'
ID479078
Institutional Source Beutler Lab
Gene Symbol Hmgcl
Ensembl Gene ENSMUSG00000028672
Gene Name3-hydroxy-3-methylglutaryl-Coenzyme A lyase
Synonyms
MMRRC Submission 044196-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6024 (G1)
Quality Score176.009
Status Validated
Chromosome4
Chromosomal Location135946448-135962617 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135955615 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 126 (V126A)
Ref Sequence ENSEMBL: ENSMUSP00000030432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030432]
Predicted Effect probably benign
Transcript: ENSMUST00000030432
AA Change: V126A

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000030432
Gene: ENSMUSG00000028672
AA Change: V126A

DomainStartEndE-ValueType
Pfam:HMGL-like 32 306 2.4e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151879
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the HMG-CoA lyase family. It is a mitochondrial enzyme that catalyzes the final step of leucine degradation and plays a key role in ketone body formation. Mutations in this gene are associated with HMG-CoA lyase deficiency. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele die at midgestation exhibiting reduced embryo size, frequent cytoplasmic vacuolization in liver, heart and placenta, and marked focal hydropic swelling of mitochondria in hepatocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A G 13: 81,476,505 F3782L probably benign Het
Akr1d1 T C 6: 37,558,482 I267T probably benign Het
Arhgef5 T C 6: 43,275,134 S940P probably benign Het
Art2b A G 7: 101,580,380 I104T probably benign Het
Avpr1a A G 10: 122,449,148 Y115C probably damaging Het
Ccdc84 T C 9: 44,417,952 T13A possibly damaging Het
Cdc42bpg T A 19: 6,317,496 L995Q probably damaging Het
Clip1 T C 5: 123,615,089 K210E possibly damaging Het
Cog4 C T 8: 110,881,480 T735I probably damaging Het
Creb3l4 G A 3: 90,238,699 S206L probably damaging Het
Csf3r C A 4: 126,037,517 probably null Het
Dnah11 G T 12: 118,030,272 S2346R probably benign Het
Dnaic2 A T 11: 114,752,908 I467F possibly damaging Het
Doxl2 A T 6: 48,976,096 K318N possibly damaging Het
Dpy19l4 A T 4: 11,276,876 M523K probably damaging Het
Ebf3 T C 7: 137,200,535 D407G probably damaging Het
Fbn2 A G 18: 58,076,836 I991T probably benign Het
Gcc1 T C 6: 28,419,300 T345A probably benign Het
Gm1527 C T 3: 28,920,603 H522Y probably benign Het
Gm340 C A 19: 41,583,957 P384T possibly damaging Het
Gm4846 T A 1: 166,490,127 Y240F probably benign Het
Ifit1bl2 G T 19: 34,620,038 S59R probably benign Het
Itga6 A G 2: 71,787,233 N32S probably benign Het
Macc1 T C 12: 119,450,425 S779P probably benign Het
Mctp1 G T 13: 76,385,161 L209F probably damaging Het
Mink1 A G 11: 70,599,089 N97S possibly damaging Het
Mst1r T A 9: 107,908,151 V336E probably benign Het
Muc16 A T 9: 18,646,671 S2775R unknown Het
Muc6 T A 7: 141,641,574 T1316S possibly damaging Het
Myh11 T A 16: 14,277,703 N65I probably damaging Het
Myo9a A G 9: 59,855,388 N801D possibly damaging Het
Nkain2 A T 10: 31,951,285 M103K probably damaging Het
Nkx2-2 T A 2: 147,184,041 Y259F probably benign Het
Nrxn1 T C 17: 90,590,098 M877V possibly damaging Het
Nxf1 C T 19: 8,767,744 L453F probably damaging Het
Pcnt T C 10: 76,420,037 S790G possibly damaging Het
Phf3 T C 1: 30,863,226 D2G probably damaging Het
Phrf1 T C 7: 141,258,985 probably benign Het
Ptpn3 C A 4: 57,248,653 probably null Het
Pygl T C 12: 70,197,067 T625A probably benign Het
R3hdm2 T A 10: 127,459,480 F239I probably damaging Het
Sesn1 A T 10: 41,896,200 I242F probably damaging Het
Shank2 C T 7: 144,180,031 T105I probably benign Het
Skint3 T C 4: 112,290,346 F350S possibly damaging Het
Slco5a1 T C 1: 12,944,070 Y320C probably damaging Het
Syt11 A G 3: 88,762,109 S159P probably benign Het
Tanc2 G A 11: 105,867,717 R768Q probably damaging Het
Tanc2 T C 11: 105,923,672 S1981P probably damaging Het
Tmem200c A C 17: 68,841,727 D435A possibly damaging Het
Trappc8 A G 18: 20,833,009 V1125A probably damaging Het
Ttn A G 2: 76,814,143 V4762A possibly damaging Het
Unc5d A G 8: 28,875,511 S149P possibly damaging Het
Usf3 A T 16: 44,219,840 N1561I probably damaging Het
Wdr4 A T 17: 31,501,298 probably benign Het
Wdr49 T G 3: 75,301,826 E612D probably benign Het
Other mutations in Hmgcl
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0226:Hmgcl UTSW 4 135958728 missense probably damaging 1.00
R0825:Hmgcl UTSW 4 135960070 missense probably benign
R2400:Hmgcl UTSW 4 135952368 splice site probably null
R3791:Hmgcl UTSW 4 135959987 missense probably benign 0.00
R4063:Hmgcl UTSW 4 135958724 missense probably damaging 1.00
R5000:Hmgcl UTSW 4 135962200 missense probably benign 0.01
R5754:Hmgcl UTSW 4 135950587 missense probably damaging 0.98
R6658:Hmgcl UTSW 4 135955651 missense probably damaging 0.96
R6889:Hmgcl UTSW 4 135955642 missense probably benign 0.33
R7074:Hmgcl UTSW 4 135953867 missense probably benign 0.00
R7238:Hmgcl UTSW 4 135962113 missense possibly damaging 0.92
R7733:Hmgcl UTSW 4 135960083 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCAAGCCATCACAGAATTGCT -3'
(R):5'- GGGGAATCCACCTACACTCT -3'

Sequencing Primer
(F):5'- CCTGTTCCCAAGTAGGTAACATGG -3'
(R):5'- ACTCTACAAGGGTCCCGAG -3'
Posted On2017-06-26