Incidental Mutation 'R6024:Clip1'
ID479079
Institutional Source Beutler Lab
Gene Symbol Clip1
Ensembl Gene ENSMUSG00000049550
Gene NameCAP-GLY domain containing linker protein 1
SynonymsClip50, 4631429H07Rik, CLIP-170, restin, Rsn, Clip 170, 1110007I12Rik, cytoplasmic linker protein 50
MMRRC Submission 044196-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6024 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location123577795-123684618 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123615089 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 210 (K210E)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031382] [ENSMUST00000063905] [ENSMUST00000111561] [ENSMUST00000111564] [ENSMUST00000111566] [ENSMUST00000149410]
Predicted Effect probably benign
Transcript: ENSMUST00000031382
SMART Domains Protein: ENSMUSP00000031382
Gene: ENSMUSG00000049550

DomainStartEndE-ValueType
internal_repeat_2 11 53 2.28e-5 PROSPERO
CAP_GLY 60 125 1.05e-31 SMART
internal_repeat_2 140 177 2.28e-5 PROSPERO
CAP_GLY 213 278 4.69e-34 SMART
low complexity region 286 304 N/A INTRINSIC
low complexity region 305 331 N/A INTRINSIC
coiled coil region 349 451 N/A INTRINSIC
coiled coil region 474 535 N/A INTRINSIC
coiled coil region 581 620 N/A INTRINSIC
coiled coil region 652 1352 N/A INTRINSIC
low complexity region 1362 1373 N/A INTRINSIC
Pfam:CLIP1_ZNF 1375 1392 5.8e-9 PFAM
ZnF_C2HC 1417 1433 1.45e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063905
SMART Domains Protein: ENSMUSP00000068241
Gene: ENSMUSG00000049550

DomainStartEndE-ValueType
internal_repeat_2 11 53 3.3e-5 PROSPERO
CAP_GLY 60 125 1.05e-31 SMART
internal_repeat_2 140 177 3.3e-5 PROSPERO
CAP_GLY 213 278 4.69e-34 SMART
low complexity region 286 304 N/A INTRINSIC
low complexity region 305 331 N/A INTRINSIC
coiled coil region 349 524 N/A INTRINSIC
coiled coil region 570 609 N/A INTRINSIC
coiled coil region 641 1075 N/A INTRINSIC
coiled coil region 1115 1235 N/A INTRINSIC
low complexity region 1245 1256 N/A INTRINSIC
ZnF_C2HC 1300 1316 1.45e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111561
SMART Domains Protein: ENSMUSP00000107186
Gene: ENSMUSG00000049550

DomainStartEndE-ValueType
internal_repeat_2 11 53 1.93e-5 PROSPERO
CAP_GLY 60 125 1.05e-31 SMART
internal_repeat_2 140 177 1.93e-5 PROSPERO
CAP_GLY 213 278 4.69e-34 SMART
low complexity region 286 304 N/A INTRINSIC
low complexity region 305 331 N/A INTRINSIC
coiled coil region 349 524 N/A INTRINSIC
coiled coil region 570 609 N/A INTRINSIC
coiled coil region 641 1341 N/A INTRINSIC
low complexity region 1351 1362 N/A INTRINSIC
ZnF_C2HC 1406 1422 1.45e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111564
SMART Domains Protein: ENSMUSP00000107190
Gene: ENSMUSG00000049550

DomainStartEndE-ValueType
internal_repeat_2 11 53 2.5e-5 PROSPERO
CAP_GLY 60 125 1.05e-31 SMART
internal_repeat_2 140 177 2.5e-5 PROSPERO
CAP_GLY 213 278 4.69e-34 SMART
low complexity region 286 304 N/A INTRINSIC
low complexity region 305 331 N/A INTRINSIC
coiled coil region 349 489 N/A INTRINSIC
coiled coil region 535 574 N/A INTRINSIC
coiled coil region 606 1230 N/A INTRINSIC
low complexity region 1240 1251 N/A INTRINSIC
ZnF_C2HC 1295 1311 1.45e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111566
SMART Domains Protein: ENSMUSP00000107192
Gene: ENSMUSG00000049550

DomainStartEndE-ValueType
internal_repeat_2 11 53 2e-5 PROSPERO
CAP_GLY 60 125 1.05e-31 SMART
internal_repeat_2 140 177 2e-5 PROSPERO
CAP_GLY 213 278 4.69e-34 SMART
low complexity region 286 304 N/A INTRINSIC
low complexity region 305 331 N/A INTRINSIC
coiled coil region 349 489 N/A INTRINSIC
coiled coil region 535 574 N/A INTRINSIC
coiled coil region 606 1306 N/A INTRINSIC
low complexity region 1316 1327 N/A INTRINSIC
ZnF_C2HC 1371 1387 1.45e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133545
Predicted Effect probably benign
Transcript: ENSMUST00000137363
SMART Domains Protein: ENSMUSP00000121425
Gene: ENSMUSG00000049550

DomainStartEndE-ValueType
CAP_GLY 2 31 2.59e0 SMART
low complexity region 39 57 N/A INTRINSIC
low complexity region 58 84 N/A INTRINSIC
coiled coil region 101 276 N/A INTRINSIC
coiled coil region 322 361 N/A INTRINSIC
coiled coil region 393 980 N/A INTRINSIC
low complexity region 991 1002 N/A INTRINSIC
Pfam:CLIP1_ZNF 1004 1021 4.2e-9 PFAM
ZnF_C2HC 1046 1062 1.45e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137602
Predicted Effect probably benign
Transcript: ENSMUST00000144121
SMART Domains Protein: ENSMUSP00000119641
Gene: ENSMUSG00000049550

DomainStartEndE-ValueType
CAP_GLY 37 102 1.05e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149410
SMART Domains Protein: ENSMUSP00000115965
Gene: ENSMUSG00000049550

DomainStartEndE-ValueType
low complexity region 26 32 N/A INTRINSIC
CAP_GLY 60 125 1.05e-31 SMART
CAP_GLY 213 278 4.69e-34 SMART
low complexity region 286 304 N/A INTRINSIC
low complexity region 305 331 N/A INTRINSIC
coiled coil region 334 458 N/A INTRINSIC
coiled coil region 504 543 N/A INTRINSIC
coiled coil region 575 827 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000154672
AA Change: K210E

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000122064
Gene: ENSMUSG00000049550
AA Change: K210E

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
low complexity region 165 176 N/A INTRINSIC
internal_repeat_1 352 375 1.56e-8 PROSPERO
internal_repeat_3 358 377 5.32e-6 PROSPERO
internal_repeat_1 450 473 1.56e-8 PROSPERO
internal_repeat_3 544 563 5.32e-6 PROSPERO
internal_repeat_2 553 575 2.88e-7 PROSPERO
low complexity region 735 744 N/A INTRINSIC
internal_repeat_2 781 803 2.88e-7 PROSPERO
low complexity region 819 830 N/A INTRINSIC
low complexity region 962 977 N/A INTRINSIC
low complexity region 1081 1099 N/A INTRINSIC
low complexity region 1110 1121 N/A INTRINSIC
low complexity region 1164 1175 N/A INTRINSIC
Meta Mutation Damage Score 0.0700 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene links endocytic vesicles to microtubules. This gene is highly expressed in Reed-Sternberg cells of Hodgkin disease. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted allele display reduced male fertility and teratozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A G 13: 81,476,505 F3782L probably benign Het
Akr1d1 T C 6: 37,558,482 I267T probably benign Het
Arhgef5 T C 6: 43,275,134 S940P probably benign Het
Art2b A G 7: 101,580,380 I104T probably benign Het
Avpr1a A G 10: 122,449,148 Y115C probably damaging Het
Ccdc84 T C 9: 44,417,952 T13A possibly damaging Het
Cdc42bpg T A 19: 6,317,496 L995Q probably damaging Het
Cog4 C T 8: 110,881,480 T735I probably damaging Het
Creb3l4 G A 3: 90,238,699 S206L probably damaging Het
Csf3r C A 4: 126,037,517 probably null Het
Dnah11 G T 12: 118,030,272 S2346R probably benign Het
Dnaic2 A T 11: 114,752,908 I467F possibly damaging Het
Doxl2 A T 6: 48,976,096 K318N possibly damaging Het
Dpy19l4 A T 4: 11,276,876 M523K probably damaging Het
Ebf3 T C 7: 137,200,535 D407G probably damaging Het
Fbn2 A G 18: 58,076,836 I991T probably benign Het
Gcc1 T C 6: 28,419,300 T345A probably benign Het
Gm1527 C T 3: 28,920,603 H522Y probably benign Het
Gm340 C A 19: 41,583,957 P384T possibly damaging Het
Gm4846 T A 1: 166,490,127 Y240F probably benign Het
Hmgcl T C 4: 135,955,615 V126A probably benign Het
Ifit1bl2 G T 19: 34,620,038 S59R probably benign Het
Itga6 A G 2: 71,787,233 N32S probably benign Het
Macc1 T C 12: 119,450,425 S779P probably benign Het
Mctp1 G T 13: 76,385,161 L209F probably damaging Het
Mink1 A G 11: 70,599,089 N97S possibly damaging Het
Mst1r T A 9: 107,908,151 V336E probably benign Het
Muc16 A T 9: 18,646,671 S2775R unknown Het
Muc6 T A 7: 141,641,574 T1316S possibly damaging Het
Myh11 T A 16: 14,277,703 N65I probably damaging Het
Myo9a A G 9: 59,855,388 N801D possibly damaging Het
Nkain2 A T 10: 31,951,285 M103K probably damaging Het
Nkx2-2 T A 2: 147,184,041 Y259F probably benign Het
Nrxn1 T C 17: 90,590,098 M877V possibly damaging Het
Nxf1 C T 19: 8,767,744 L453F probably damaging Het
Pcnt T C 10: 76,420,037 S790G possibly damaging Het
Phf3 T C 1: 30,863,226 D2G probably damaging Het
Phrf1 T C 7: 141,258,985 probably benign Het
Ptpn3 C A 4: 57,248,653 probably null Het
Pygl T C 12: 70,197,067 T625A probably benign Het
R3hdm2 T A 10: 127,459,480 F239I probably damaging Het
Sesn1 A T 10: 41,896,200 I242F probably damaging Het
Shank2 C T 7: 144,180,031 T105I probably benign Het
Skint3 T C 4: 112,290,346 F350S possibly damaging Het
Slco5a1 T C 1: 12,944,070 Y320C probably damaging Het
Syt11 A G 3: 88,762,109 S159P probably benign Het
Tanc2 G A 11: 105,867,717 R768Q probably damaging Het
Tanc2 T C 11: 105,923,672 S1981P probably damaging Het
Tmem200c A C 17: 68,841,727 D435A possibly damaging Het
Trappc8 A G 18: 20,833,009 V1125A probably damaging Het
Ttn A G 2: 76,814,143 V4762A possibly damaging Het
Unc5d A G 8: 28,875,511 S149P possibly damaging Het
Usf3 A T 16: 44,219,840 N1561I probably damaging Het
Wdr4 A T 17: 31,501,298 probably benign Het
Wdr49 T G 3: 75,301,826 E612D probably benign Het
Other mutations in Clip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Clip1 APN 5 123603654 missense possibly damaging 0.94
IGL01067:Clip1 APN 5 123630804 missense probably damaging 0.99
IGL01524:Clip1 APN 5 123579379 missense probably damaging 1.00
IGL01632:Clip1 APN 5 123617496 missense probably damaging 1.00
IGL01798:Clip1 APN 5 123583549 missense probably damaging 1.00
IGL01874:Clip1 APN 5 123603666 missense possibly damaging 0.50
IGL01908:Clip1 APN 5 123623207 splice site probably benign
IGL02120:Clip1 APN 5 123647883 missense probably damaging 1.00
IGL02309:Clip1 APN 5 123617700 missense probably damaging 0.99
IGL02555:Clip1 APN 5 123621794 critical splice donor site probably null
IGL03027:Clip1 APN 5 123621856 missense probably benign 0.43
IGL03336:Clip1 APN 5 123653570 nonsense probably null
IGL03365:Clip1 APN 5 123583586 missense probably damaging 1.00
IGL02802:Clip1 UTSW 5 123631123 missense probably damaging 1.00
PIT4812001:Clip1 UTSW 5 123630675 missense probably benign 0.08
R0254:Clip1 UTSW 5 123617332 splice site probably benign
R0401:Clip1 UTSW 5 123653789 missense probably damaging 1.00
R0530:Clip1 UTSW 5 123640531 missense probably damaging 1.00
R0744:Clip1 UTSW 5 123630721 missense probably benign 0.05
R0833:Clip1 UTSW 5 123630721 missense probably benign 0.05
R1116:Clip1 UTSW 5 123579491 missense probably damaging 0.99
R1182:Clip1 UTSW 5 123647865 missense probably damaging 1.00
R1656:Clip1 UTSW 5 123630403 missense possibly damaging 0.61
R1700:Clip1 UTSW 5 123630370 missense probably benign
R1889:Clip1 UTSW 5 123653496 missense probably damaging 0.99
R1975:Clip1 UTSW 5 123623218 missense possibly damaging 0.79
R2406:Clip1 UTSW 5 123603660 missense probably damaging 1.00
R3545:Clip1 UTSW 5 123631078 missense probably damaging 1.00
R3547:Clip1 UTSW 5 123631078 missense probably damaging 1.00
R3548:Clip1 UTSW 5 123631078 missense probably damaging 1.00
R3911:Clip1 UTSW 5 123590834 missense probably damaging 1.00
R3944:Clip1 UTSW 5 123617829 unclassified probably benign
R4660:Clip1 UTSW 5 123579374 missense probably damaging 0.98
R4784:Clip1 UTSW 5 123579293 missense probably damaging 1.00
R4785:Clip1 UTSW 5 123579293 missense probably damaging 1.00
R4824:Clip1 UTSW 5 123631023 missense probably damaging 1.00
R4831:Clip1 UTSW 5 123583601 missense probably damaging 1.00
R4951:Clip1 UTSW 5 123630345 missense probably benign 0.02
R4960:Clip1 UTSW 5 123654003 nonsense probably null
R5014:Clip1 UTSW 5 123617730 missense probably damaging 0.99
R5116:Clip1 UTSW 5 123630707 missense probably benign 0.05
R5212:Clip1 UTSW 5 123630681 missense probably benign 0.09
R5238:Clip1 UTSW 5 123647883 missense probably damaging 1.00
R5318:Clip1 UTSW 5 123613084 unclassified probably benign
R5372:Clip1 UTSW 5 123630240 missense probably benign 0.02
R5701:Clip1 UTSW 5 123613303 unclassified probably benign
R5734:Clip1 UTSW 5 123615154 unclassified probably benign
R5757:Clip1 UTSW 5 123627397 missense probably benign 0.21
R6160:Clip1 UTSW 5 123613541 missense possibly damaging 0.66
R6177:Clip1 UTSW 5 123613834 unclassified probably benign
R6183:Clip1 UTSW 5 123642604 missense probably damaging 1.00
R6377:Clip1 UTSW 5 123603654 missense possibly damaging 0.50
R6436:Clip1 UTSW 5 123641785 missense probably damaging 1.00
R6471:Clip1 UTSW 5 123640549 missense probably damaging 0.99
R6766:Clip1 UTSW 5 123614764 unclassified probably benign
R7015:Clip1 UTSW 5 123613612 unclassified probably benign
R7094:Clip1 UTSW 5 123623270 missense probably benign 0.02
R7143:Clip1 UTSW 5 123653610 missense probably benign
R7222:Clip1 UTSW 5 123611841 missense probably damaging 0.99
R7233:Clip1 UTSW 5 123611859 missense probably damaging 1.00
R7238:Clip1 UTSW 5 123613265 missense
R7249:Clip1 UTSW 5 123603600 missense probably damaging 1.00
R7283:Clip1 UTSW 5 123613794 missense
R7295:Clip1 UTSW 5 123627356 missense probably benign 0.19
R7447:Clip1 UTSW 5 123653633 missense probably benign 0.03
R7458:Clip1 UTSW 5 123640546 missense probably damaging 1.00
R7483:Clip1 UTSW 5 123617384 missense probably benign 0.00
R7516:Clip1 UTSW 5 123583385 missense probably benign 0.00
R7619:Clip1 UTSW 5 123614279 missense
R7831:Clip1 UTSW 5 123613279 missense
R7897:Clip1 UTSW 5 123622798 missense probably benign
R8155:Clip1 UTSW 5 123613636 missense
R8157:Clip1 UTSW 5 123630719 missense probably benign 0.17
R8232:Clip1 UTSW 5 123647918 missense probably benign 0.05
R8396:Clip1 UTSW 5 123642564 missense probably damaging 1.00
R8446:Clip1 UTSW 5 123655945 missense probably damaging 1.00
R8486:Clip1 UTSW 5 123614707 unclassified probably benign
R8511:Clip1 UTSW 5 123653906 missense possibly damaging 0.50
Z1177:Clip1 UTSW 5 123617350 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGGCCATCAGCTTGTCCTTG -3'
(R):5'- GAGCTGAGGGGTCTGAAATC -3'

Sequencing Primer
(F):5'- ATCAGCTTGTCCTTGCAGAAG -3'
(R):5'- TCAGAGAAGCAGCTCTATGC -3'
Posted On2017-06-26