Incidental Mutation 'R6024:Arhgef5'
ID 479082
Institutional Source Beutler Lab
Gene Symbol Arhgef5
Ensembl Gene ENSMUSG00000033542
Gene Name Rho guanine nucleotide exchange factor 5
Synonyms 2210412D05Rik
MMRRC Submission 044196-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6024 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 43242578-43266254 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43252068 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 940 (S940P)
Ref Sequence ENSEMBL: ENSMUSP00000031750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031750]
AlphaFold E9Q7D5
Predicted Effect probably benign
Transcript: ENSMUST00000031750
AA Change: S940P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: S940P

DomainStartEndE-ValueType
Pfam:ARHGEF5_35 1 477 3.1e-220 PFAM
low complexity region 509 531 N/A INTRINSIC
low complexity region 812 825 N/A INTRINSIC
low complexity region 827 851 N/A INTRINSIC
RhoGEF 1162 1341 2.97e-57 SMART
PH 1375 1488 1.11e-6 SMART
SH3 1497 1554 6.39e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182190
Predicted Effect unknown
Transcript: ENSMUST00000182924
AA Change: S208P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203387
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A G 13: 81,624,624 (GRCm39) F3782L probably benign Het
Akr1d1 T C 6: 37,535,417 (GRCm39) I267T probably benign Het
Aoc1l1 A T 6: 48,953,030 (GRCm39) K318N possibly damaging Het
Art2b A G 7: 101,229,587 (GRCm39) I104T probably benign Het
Avpr1a A G 10: 122,285,053 (GRCm39) Y115C probably damaging Het
Cdc42bpg T A 19: 6,367,526 (GRCm39) L995Q probably damaging Het
Cenatac T C 9: 44,329,249 (GRCm39) T13A possibly damaging Het
Clip1 T C 5: 123,753,152 (GRCm39) K210E possibly damaging Het
Cog4 C T 8: 111,608,112 (GRCm39) T735I probably damaging Het
Creb3l4 G A 3: 90,146,006 (GRCm39) S206L probably damaging Het
Csf3r C A 4: 125,931,310 (GRCm39) probably null Het
Dnah11 G T 12: 117,994,007 (GRCm39) S2346R probably benign Het
Dnai2 A T 11: 114,643,734 (GRCm39) I467F possibly damaging Het
Dpy19l4 A T 4: 11,276,876 (GRCm39) M523K probably damaging Het
Ebf3 T C 7: 136,802,264 (GRCm39) D407G probably damaging Het
Fbn2 A G 18: 58,209,908 (GRCm39) I991T probably benign Het
Gcc1 T C 6: 28,419,299 (GRCm39) T345A probably benign Het
Gm1527 C T 3: 28,974,752 (GRCm39) H522Y probably benign Het
Gm4846 T A 1: 166,317,696 (GRCm39) Y240F probably benign Het
Hmgcl T C 4: 135,682,926 (GRCm39) V126A probably benign Het
Ifit1bl2 G T 19: 34,597,438 (GRCm39) S59R probably benign Het
Itga6 A G 2: 71,617,577 (GRCm39) N32S probably benign Het
Lcor C A 19: 41,572,396 (GRCm39) P384T possibly damaging Het
Macc1 T C 12: 119,414,160 (GRCm39) S779P probably benign Het
Mctp1 G T 13: 76,533,280 (GRCm39) L209F probably damaging Het
Mink1 A G 11: 70,489,915 (GRCm39) N97S possibly damaging Het
Mst1r T A 9: 107,785,350 (GRCm39) V336E probably benign Het
Muc16 A T 9: 18,557,967 (GRCm39) S2775R unknown Het
Muc6 T A 7: 141,227,841 (GRCm39) T1316S possibly damaging Het
Myh11 T A 16: 14,095,567 (GRCm39) N65I probably damaging Het
Myo9a A G 9: 59,762,671 (GRCm39) N801D possibly damaging Het
Nkain2 A T 10: 31,827,281 (GRCm39) M103K probably damaging Het
Nkx2-2 T A 2: 147,025,961 (GRCm39) Y259F probably benign Het
Nrxn1 T C 17: 90,897,526 (GRCm39) M877V possibly damaging Het
Nxf1 C T 19: 8,745,108 (GRCm39) L453F probably damaging Het
Pcnt T C 10: 76,255,871 (GRCm39) S790G possibly damaging Het
Phf3 T C 1: 30,902,307 (GRCm39) D2G probably damaging Het
Phrf1 T C 7: 140,838,898 (GRCm39) probably benign Het
Ptpn3 C A 4: 57,248,653 (GRCm39) probably null Het
Pygl T C 12: 70,243,841 (GRCm39) T625A probably benign Het
R3hdm2 T A 10: 127,295,349 (GRCm39) F239I probably damaging Het
Sesn1 A T 10: 41,772,196 (GRCm39) I242F probably damaging Het
Shank2 C T 7: 143,733,768 (GRCm39) T105I probably benign Het
Skint3 T C 4: 112,147,543 (GRCm39) F350S possibly damaging Het
Slco5a1 T C 1: 13,014,294 (GRCm39) Y320C probably damaging Het
Syt11 A G 3: 88,669,416 (GRCm39) S159P probably benign Het
Tanc2 G A 11: 105,758,543 (GRCm39) R768Q probably damaging Het
Tanc2 T C 11: 105,814,498 (GRCm39) S1981P probably damaging Het
Tmem200c A C 17: 69,148,722 (GRCm39) D435A possibly damaging Het
Trappc8 A G 18: 20,966,066 (GRCm39) V1125A probably damaging Het
Ttn A G 2: 76,644,487 (GRCm39) V4762A possibly damaging Het
Unc5d A G 8: 29,365,539 (GRCm39) S149P possibly damaging Het
Usf3 A T 16: 44,040,203 (GRCm39) N1561I probably damaging Het
Wdr4 A T 17: 31,720,272 (GRCm39) probably benign Het
Wdr49 T G 3: 75,209,133 (GRCm39) E612D probably benign Het
Other mutations in Arhgef5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Arhgef5 APN 6 43,257,203 (GRCm39) nonsense probably null
IGL01341:Arhgef5 APN 6 43,260,925 (GRCm39) missense probably damaging 1.00
IGL01576:Arhgef5 APN 6 43,250,962 (GRCm39) missense probably benign 0.38
IGL01761:Arhgef5 APN 6 43,251,538 (GRCm39) missense probably benign 0.00
IGL02104:Arhgef5 APN 6 43,249,345 (GRCm39) missense probably damaging 0.99
IGL02208:Arhgef5 APN 6 43,252,064 (GRCm39) missense probably benign 0.11
IGL02487:Arhgef5 APN 6 43,260,916 (GRCm39) missense probably damaging 1.00
IGL02650:Arhgef5 APN 6 43,249,869 (GRCm39) nonsense probably null
IGL03292:Arhgef5 APN 6 43,257,180 (GRCm39) missense probably damaging 1.00
IGL03334:Arhgef5 APN 6 43,250,934 (GRCm39) missense possibly damaging 0.47
IGL03341:Arhgef5 APN 6 43,257,585 (GRCm39) missense probably damaging 0.99
R0047:Arhgef5 UTSW 6 43,242,555 (GRCm39) splice site probably null
R0206:Arhgef5 UTSW 6 43,250,275 (GRCm39) missense probably damaging 1.00
R0208:Arhgef5 UTSW 6 43,250,275 (GRCm39) missense probably damaging 1.00
R0698:Arhgef5 UTSW 6 43,250,275 (GRCm39) missense probably damaging 1.00
R1145:Arhgef5 UTSW 6 43,250,022 (GRCm39) missense possibly damaging 0.92
R1145:Arhgef5 UTSW 6 43,250,022 (GRCm39) missense possibly damaging 0.92
R1168:Arhgef5 UTSW 6 43,250,330 (GRCm39) missense probably benign 0.00
R1355:Arhgef5 UTSW 6 43,260,846 (GRCm39) missense probably damaging 1.00
R1370:Arhgef5 UTSW 6 43,260,846 (GRCm39) missense probably damaging 1.00
R1481:Arhgef5 UTSW 6 43,251,568 (GRCm39) missense probably damaging 0.99
R1529:Arhgef5 UTSW 6 43,256,449 (GRCm39) missense probably damaging 0.96
R1532:Arhgef5 UTSW 6 43,250,337 (GRCm39) missense probably benign
R1663:Arhgef5 UTSW 6 43,253,899 (GRCm39) missense probably damaging 1.00
R1742:Arhgef5 UTSW 6 43,257,133 (GRCm39) missense probably damaging 1.00
R1852:Arhgef5 UTSW 6 43,252,119 (GRCm39) missense probably benign 0.00
R1869:Arhgef5 UTSW 6 43,265,616 (GRCm39) missense probably damaging 1.00
R1880:Arhgef5 UTSW 6 43,250,022 (GRCm39) missense possibly damaging 0.92
R2146:Arhgef5 UTSW 6 43,260,252 (GRCm39) missense probably damaging 1.00
R2169:Arhgef5 UTSW 6 43,251,354 (GRCm39) missense probably benign 0.11
R3412:Arhgef5 UTSW 6 43,250,724 (GRCm39) missense probably benign
R4205:Arhgef5 UTSW 6 43,250,766 (GRCm39) missense possibly damaging 0.76
R4226:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4227:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4304:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4308:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4457:Arhgef5 UTSW 6 43,251,027 (GRCm39) missense probably damaging 1.00
R4469:Arhgef5 UTSW 6 43,252,033 (GRCm39) missense probably benign
R4636:Arhgef5 UTSW 6 43,251,876 (GRCm39) missense probably benign 0.11
R4791:Arhgef5 UTSW 6 43,260,117 (GRCm39) missense probably damaging 1.00
R4818:Arhgef5 UTSW 6 43,250,484 (GRCm39) missense probably benign 0.00
R4910:Arhgef5 UTSW 6 43,249,762 (GRCm39) missense probably benign 0.01
R4911:Arhgef5 UTSW 6 43,249,762 (GRCm39) missense probably benign 0.01
R5127:Arhgef5 UTSW 6 43,250,148 (GRCm39) missense probably damaging 0.99
R5209:Arhgef5 UTSW 6 43,250,634 (GRCm39) missense probably benign 0.01
R5245:Arhgef5 UTSW 6 43,242,614 (GRCm39) start gained probably benign
R5251:Arhgef5 UTSW 6 43,249,815 (GRCm39) missense possibly damaging 0.76
R5513:Arhgef5 UTSW 6 43,249,273 (GRCm39) missense probably damaging 0.96
R5613:Arhgef5 UTSW 6 43,250,997 (GRCm39) missense probably benign 0.01
R5616:Arhgef5 UTSW 6 43,252,874 (GRCm39) missense probably benign 0.20
R5817:Arhgef5 UTSW 6 43,252,038 (GRCm39) missense probably benign 0.15
R6735:Arhgef5 UTSW 6 43,251,966 (GRCm39) missense probably benign 0.01
R6825:Arhgef5 UTSW 6 43,251,895 (GRCm39) missense probably damaging 0.99
R6831:Arhgef5 UTSW 6 43,257,933 (GRCm39) missense probably damaging 1.00
R6901:Arhgef5 UTSW 6 43,250,232 (GRCm39) missense probably benign 0.00
R6932:Arhgef5 UTSW 6 43,251,351 (GRCm39) missense possibly damaging 0.94
R6968:Arhgef5 UTSW 6 43,252,276 (GRCm39) missense probably benign 0.00
R7018:Arhgef5 UTSW 6 43,265,665 (GRCm39) missense probably damaging 1.00
R7180:Arhgef5 UTSW 6 43,252,142 (GRCm39) missense possibly damaging 0.87
R7201:Arhgef5 UTSW 6 43,250,166 (GRCm39) nonsense probably null
R7358:Arhgef5 UTSW 6 43,256,507 (GRCm39) missense probably damaging 1.00
R7359:Arhgef5 UTSW 6 43,257,216 (GRCm39) missense probably damaging 1.00
R7468:Arhgef5 UTSW 6 43,257,605 (GRCm39) nonsense probably null
R7503:Arhgef5 UTSW 6 43,250,933 (GRCm39) missense probably benign 0.15
R7699:Arhgef5 UTSW 6 43,251,691 (GRCm39) missense probably benign 0.11
R7700:Arhgef5 UTSW 6 43,251,691 (GRCm39) missense probably benign 0.11
R7737:Arhgef5 UTSW 6 43,250,728 (GRCm39) missense possibly damaging 0.84
R7847:Arhgef5 UTSW 6 43,252,069 (GRCm39) nonsense probably null
R7950:Arhgef5 UTSW 6 43,250,859 (GRCm39) missense possibly damaging 0.76
R8161:Arhgef5 UTSW 6 43,260,885 (GRCm39) missense probably damaging 1.00
R8178:Arhgef5 UTSW 6 43,252,119 (GRCm39) missense probably benign 0.00
R8203:Arhgef5 UTSW 6 43,257,579 (GRCm39) missense probably damaging 1.00
R8318:Arhgef5 UTSW 6 43,252,933 (GRCm39) critical splice donor site probably null
R8857:Arhgef5 UTSW 6 43,264,558 (GRCm39) missense probably damaging 1.00
R9499:Arhgef5 UTSW 6 43,260,940 (GRCm39) missense
R9610:Arhgef5 UTSW 6 43,257,890 (GRCm39) missense probably damaging 0.99
R9611:Arhgef5 UTSW 6 43,257,890 (GRCm39) missense probably damaging 0.99
R9623:Arhgef5 UTSW 6 43,251,736 (GRCm39) missense possibly damaging 0.86
R9685:Arhgef5 UTSW 6 43,250,527 (GRCm39) missense probably benign 0.11
RF023:Arhgef5 UTSW 6 43,256,407 (GRCm39) missense probably damaging 1.00
X0028:Arhgef5 UTSW 6 43,250,635 (GRCm39) missense probably benign 0.03
X0065:Arhgef5 UTSW 6 43,249,342 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCTGTTGGACGAACCTCCTG -3'
(R):5'- TCAGGCAAAATTGAAGGTCTACG -3'

Sequencing Primer
(F):5'- ACGAACCTCCTGGCCTC -3'
(R):5'- GGTCTACGAAGGCCTTGC -3'
Posted On 2017-06-26