Incidental Mutation 'R6024:Doxl2'
ID479083
Institutional Source Beutler Lab
Gene Symbol Doxl2
Ensembl Gene ENSMUSG00000068536
Gene Namediamine oxidase-like protein 2
Synonyms
MMRRC Submission 044196-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6024 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location48974963-48978746 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48976096 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 318 (K318N)
Ref Sequence ENSEMBL: ENSMUSP00000139012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090063] [ENSMUST00000184917]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090063
AA Change: K318N

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000087517
Gene: ENSMUSG00000068536
AA Change: K318N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 44 130 1.8e-26 PFAM
Pfam:Cu_amine_oxidN3 146 246 2.5e-16 PFAM
Pfam:Cu_amine_oxid 298 708 1.3e-91 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184852
SMART Domains Protein: ENSMUSP00000139236
Gene: ENSMUSG00000068536

DomainStartEndE-ValueType
Pfam:Cu_amine_oxid 15 212 2.4e-39 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000184917
AA Change: K318N

PolyPhen 2 Score 0.709 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139012
Gene: ENSMUSG00000068536
AA Change: K318N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 44 130 1.1e-21 PFAM
Pfam:Cu_amine_oxidN3 146 246 3.1e-14 PFAM
Pfam:Cu_amine_oxid 298 711 1.4e-96 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A G 13: 81,476,505 F3782L probably benign Het
Akr1d1 T C 6: 37,558,482 I267T probably benign Het
Arhgef5 T C 6: 43,275,134 S940P probably benign Het
Art2b A G 7: 101,580,380 I104T probably benign Het
Avpr1a A G 10: 122,449,148 Y115C probably damaging Het
Ccdc84 T C 9: 44,417,952 T13A possibly damaging Het
Cdc42bpg T A 19: 6,317,496 L995Q probably damaging Het
Clip1 T C 5: 123,615,089 K210E possibly damaging Het
Cog4 C T 8: 110,881,480 T735I probably damaging Het
Creb3l4 G A 3: 90,238,699 S206L probably damaging Het
Csf3r C A 4: 126,037,517 probably null Het
Dnah11 G T 12: 118,030,272 S2346R probably benign Het
Dnaic2 A T 11: 114,752,908 I467F possibly damaging Het
Dpy19l4 A T 4: 11,276,876 M523K probably damaging Het
Ebf3 T C 7: 137,200,535 D407G probably damaging Het
Fbn2 A G 18: 58,076,836 I991T probably benign Het
Gcc1 T C 6: 28,419,300 T345A probably benign Het
Gm1527 C T 3: 28,920,603 H522Y probably benign Het
Gm340 C A 19: 41,583,957 P384T possibly damaging Het
Gm4846 T A 1: 166,490,127 Y240F probably benign Het
Hmgcl T C 4: 135,955,615 V126A probably benign Het
Ifit1bl2 G T 19: 34,620,038 S59R probably benign Het
Itga6 A G 2: 71,787,233 N32S probably benign Het
Macc1 T C 12: 119,450,425 S779P probably benign Het
Mctp1 G T 13: 76,385,161 L209F probably damaging Het
Mink1 A G 11: 70,599,089 N97S possibly damaging Het
Mst1r T A 9: 107,908,151 V336E probably benign Het
Muc16 A T 9: 18,646,671 S2775R unknown Het
Muc6 T A 7: 141,641,574 T1316S possibly damaging Het
Myh11 T A 16: 14,277,703 N65I probably damaging Het
Myo9a A G 9: 59,855,388 N801D possibly damaging Het
Nkain2 A T 10: 31,951,285 M103K probably damaging Het
Nkx2-2 T A 2: 147,184,041 Y259F probably benign Het
Nrxn1 T C 17: 90,590,098 M877V possibly damaging Het
Nxf1 C T 19: 8,767,744 L453F probably damaging Het
Pcnt T C 10: 76,420,037 S790G possibly damaging Het
Phf3 T C 1: 30,863,226 D2G probably damaging Het
Phrf1 T C 7: 141,258,985 probably benign Het
Ptpn3 C A 4: 57,248,653 probably null Het
Pygl T C 12: 70,197,067 T625A probably benign Het
R3hdm2 T A 10: 127,459,480 F239I probably damaging Het
Sesn1 A T 10: 41,896,200 I242F probably damaging Het
Shank2 C T 7: 144,180,031 T105I probably benign Het
Skint3 T C 4: 112,290,346 F350S possibly damaging Het
Slco5a1 T C 1: 12,944,070 Y320C probably damaging Het
Syt11 A G 3: 88,762,109 S159P probably benign Het
Tanc2 G A 11: 105,867,717 R768Q probably damaging Het
Tanc2 T C 11: 105,923,672 S1981P probably damaging Het
Tmem200c A C 17: 68,841,727 D435A possibly damaging Het
Trappc8 A G 18: 20,833,009 V1125A probably damaging Het
Ttn A G 2: 76,814,143 V4762A possibly damaging Het
Unc5d A G 8: 28,875,511 S149P possibly damaging Het
Usf3 A T 16: 44,219,840 N1561I probably damaging Het
Wdr4 A T 17: 31,501,298 probably benign Het
Wdr49 T G 3: 75,301,826 E612D probably benign Het
Other mutations in Doxl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Doxl2 APN 6 48978131 missense possibly damaging 0.82
IGL00985:Doxl2 APN 6 48977547 missense probably benign
IGL01556:Doxl2 APN 6 48975684 missense possibly damaging 0.58
IGL02083:Doxl2 APN 6 48976260 missense probably damaging 1.00
IGL02135:Doxl2 APN 6 48975564 missense probably benign 0.11
IGL02744:Doxl2 APN 6 48975315 missense probably benign 0.15
IGL03005:Doxl2 APN 6 48976546 nonsense probably null
R0306:Doxl2 UTSW 6 48976086 missense probably damaging 1.00
R0380:Doxl2 UTSW 6 48975839 missense probably benign
R0598:Doxl2 UTSW 6 48975537 missense probably benign 0.36
R0948:Doxl2 UTSW 6 48976344 missense probably damaging 1.00
R1404:Doxl2 UTSW 6 48975833 missense probably benign 0.03
R1404:Doxl2 UTSW 6 48975833 missense probably benign 0.03
R1432:Doxl2 UTSW 6 48975654 missense probably damaging 1.00
R1443:Doxl2 UTSW 6 48975915 missense probably damaging 1.00
R1535:Doxl2 UTSW 6 48975464 missense probably damaging 0.98
R1625:Doxl2 UTSW 6 48975171 missense probably damaging 1.00
R1872:Doxl2 UTSW 6 48975620 missense probably benign 0.00
R1960:Doxl2 UTSW 6 48975753 missense probably damaging 1.00
R2031:Doxl2 UTSW 6 48975855 missense probably damaging 0.99
R2049:Doxl2 UTSW 6 48977755 nonsense probably null
R2086:Doxl2 UTSW 6 48977602 missense probably damaging 1.00
R2144:Doxl2 UTSW 6 48975291 missense probably benign 0.00
R2145:Doxl2 UTSW 6 48976695 missense probably damaging 1.00
R2152:Doxl2 UTSW 6 48976539 missense probably damaging 1.00
R2255:Doxl2 UTSW 6 48975957 missense possibly damaging 0.75
R2973:Doxl2 UTSW 6 48976424 missense probably benign 0.07
R2974:Doxl2 UTSW 6 48976424 missense probably benign 0.07
R3125:Doxl2 UTSW 6 48975371 missense probably damaging 1.00
R4321:Doxl2 UTSW 6 48976522 missense probably damaging 1.00
R4367:Doxl2 UTSW 6 48976130 missense probably damaging 1.00
R4532:Doxl2 UTSW 6 48978167 missense possibly damaging 0.77
R4575:Doxl2 UTSW 6 48977568 nonsense probably null
R4611:Doxl2 UTSW 6 48975156 missense probably benign 0.39
R4823:Doxl2 UTSW 6 48975261 missense probably damaging 1.00
R5320:Doxl2 UTSW 6 48975540 missense probably damaging 1.00
R5520:Doxl2 UTSW 6 48975794 missense possibly damaging 0.93
R5698:Doxl2 UTSW 6 48976322 missense possibly damaging 0.94
R5765:Doxl2 UTSW 6 48978537 missense probably damaging 1.00
R6061:Doxl2 UTSW 6 48976601 missense probably benign 0.02
R6268:Doxl2 UTSW 6 48977682 missense probably benign 0.01
R6564:Doxl2 UTSW 6 48977575 missense probably benign 0.00
R6640:Doxl2 UTSW 6 48977671 missense probably benign 0.21
R7131:Doxl2 UTSW 6 48976372 nonsense probably null
X0013:Doxl2 UTSW 6 48977613 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CTGGCTCAGAAATATGCAGATG -3'
(R):5'- TCTGGACAGTTGATGCCAGG -3'

Sequencing Primer
(F):5'- CTCAGAAATATGCAGATGGAGAAGTG -3'
(R):5'- ACTCGTGAGTTACAGTGCC -3'
Posted On2017-06-26