Mutagenetix > Incidental Mutations

Incidental Mutation 'R6024:Cog4'

479090

Institutional Source

Beutler Lab

Gene Symbol

Cog4

Ensembl Gene

ENSMUSG00000031753

Gene Name

component of oligomeric golgi complex 4

Synonyms

D8Ertd515e

MMRRC Submission

044196-MU

Accession Numbers

Genbank: NM_133973; MGI: 2142808

Is this an essential gene?

Probably essential (E-score: 0.942) question?

Stock #

R6024 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

110846600-110882227 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 110881480 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 735 (T735I)

Ref Sequence

ENSEMBL: ENSMUSP00000034203 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034203] [ENSMUST00000041382] [ENSMUST00000165867] [ENSMUST00000172542] [ENSMUST00000174398] [ENSMUST00000174679] [ENSMUST00000212971]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034203
AA Change: T735I

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000034203
Gene: ENSMUSG00000031753
AA Change: T735I

Domain	Start	End	E-Value	Type
low complexity region	12	23	N/A	INTRINSIC
coiled coil region	34	77	N/A	INTRINSIC
Blast:Cog4	81	178	1e-53	BLAST
Cog4	188	498	1.81e-140	SMART
Pfam:RINT1_TIP1	536	773	3.1e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000041382

SMART Domains

Protein: ENSMUSP00000039271
Gene: ENSMUSG00000033703

Domain	Start	End	E-Value	Type
low complexity region	22	37	N/A	INTRINSIC
Pfam:Fucokinase	94	496	1.7e-101	PFAM
low complexity region	807	821	N/A	INTRINSIC
Pfam:GHMP_kinases_N	827	894	3.6e-9	PFAM
Pfam:GHMP_kinases_C	970	1052	1e-8	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000165867
AA Change: T662I

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000128518
Gene: ENSMUSG00000031753
AA Change: T662I

Domain	Start	End	E-Value	Type
Blast:Cog4	8	105	6e-54	BLAST
Cog4	115	425	1.81e-140	SMART
PDB:3HR0\|B	452	712	1e-174	PDB
Blast:DIL	621	702	6e-38	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172497

Predicted Effect

probably benign
Transcript: ENSMUST00000172542

SMART Domains

Protein: ENSMUSP00000133283
Gene: ENSMUSG00000031753

Domain	Start	End	E-Value	Type
Pfam:COG4	1	156	6.3e-43	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000174398
AA Change: T713I

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000133297
Gene: ENSMUSG00000031753
AA Change: T713I

Domain	Start	End	E-Value	Type
low complexity region	11	22	N/A	INTRINSIC
coiled coil region	33	76	N/A	INTRINSIC
Blast:Cog4	80	177	9e-54	BLAST
Cog4	187	497	1.81e-140	SMART
PDB:3HR0\|B	524	763	1e-153	PDB
Blast:DIL	672	753	7e-38	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000174679

SMART Domains

Protein: ENSMUSP00000133458
Gene: ENSMUSG00000031753

Domain	Start	End	E-Value	Type
Blast:Cog4	27	174	5e-60	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180679

Predicted Effect

probably benign
Transcript: ENSMUST00000212971

Meta Mutation Damage Score

0.2706

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 93.0%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of an oligomeric protein complex involved in the structure and function of the Golgi apparatus. Defects in this gene may be a cause of congenital disorder of glycosylation type IIj. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2010]

Allele List at MGI

All alleles(13) : Gene trapped(13)

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	A	G	13: 81,476,505	F3782L	probably benign	Het
Akr1d1	T	C	6: 37,558,482	I267T	probably benign	Het
Arhgef5	T	C	6: 43,275,134	S940P	probably benign	Het
Art2b	A	G	7: 101,580,380	I104T	probably benign	Het
Avpr1a	A	G	10: 122,449,148	Y115C	probably damaging	Het
Ccdc84	T	C	9: 44,417,952	T13A	possibly damaging	Het
Cdc42bpg	T	A	19: 6,317,496	L995Q	probably damaging	Het
Clip1	T	C	5: 123,615,089	K210E	possibly damaging	Het
Creb3l4	G	A	3: 90,238,699	S206L	probably damaging	Het
Csf3r	C	A	4: 126,037,517		probably null	Het
Dnah11	G	T	12: 118,030,272	S2346R	probably benign	Het
Dnaic2	A	T	11: 114,752,908	I467F	possibly damaging	Het
Doxl2	A	T	6: 48,976,096	K318N	possibly damaging	Het
Dpy19l4	A	T	4: 11,276,876	M523K	probably damaging	Het
Ebf3	T	C	7: 137,200,535	D407G	probably damaging	Het
Fbn2	A	G	18: 58,076,836	I991T	probably benign	Het
Gcc1	T	C	6: 28,419,300	T345A	probably benign	Het
Gm1527	C	T	3: 28,920,603	H522Y	probably benign	Het
Gm340	C	A	19: 41,583,957	P384T	possibly damaging	Het
Gm4846	T	A	1: 166,490,127	Y240F	probably benign	Het
Hmgcl	T	C	4: 135,955,615	V126A	probably benign	Het
Ifit1bl2	G	T	19: 34,620,038	S59R	probably benign	Het
Itga6	A	G	2: 71,787,233	N32S	probably benign	Het
Macc1	T	C	12: 119,450,425	S779P	probably benign	Het
Mctp1	G	T	13: 76,385,161	L209F	probably damaging	Het
Mink1	A	G	11: 70,599,089	N97S	possibly damaging	Het
Mst1r	T	A	9: 107,908,151	V336E	probably benign	Het
Muc16	A	T	9: 18,646,671	S2775R	unknown	Het
Muc6	T	A	7: 141,641,574	T1316S	possibly damaging	Het
Myh11	T	A	16: 14,277,703	N65I	probably damaging	Het
Myo9a	A	G	9: 59,855,388	N801D	possibly damaging	Het
Nkain2	A	T	10: 31,951,285	M103K	probably damaging	Het
Nkx2-2	T	A	2: 147,184,041	Y259F	probably benign	Het
Nrxn1	T	C	17: 90,590,098	M877V	possibly damaging	Het
Nxf1	C	T	19: 8,767,744	L453F	probably damaging	Het
Pcnt	T	C	10: 76,420,037	S790G	possibly damaging	Het
Phf3	T	C	1: 30,863,226	D2G	probably damaging	Het
Phrf1	T	C	7: 141,258,985		probably benign	Het
Ptpn3	C	A	4: 57,248,653		probably null	Het
Pygl	T	C	12: 70,197,067	T625A	probably benign	Het
R3hdm2	T	A	10: 127,459,480	F239I	probably damaging	Het
Sesn1	A	T	10: 41,896,200	I242F	probably damaging	Het
Shank2	C	T	7: 144,180,031	T105I	probably benign	Het
Skint3	T	C	4: 112,290,346	F350S	possibly damaging	Het
Slco5a1	T	C	1: 12,944,070	Y320C	probably damaging	Het
Syt11	A	G	3: 88,762,109	S159P	probably benign	Het
Tanc2	G	A	11: 105,867,717	R768Q	probably damaging	Het
Tanc2	T	C	11: 105,923,672	S1981P	probably damaging	Het
Tmem200c	A	C	17: 68,841,727	D435A	possibly damaging	Het
Trappc8	A	G	18: 20,833,009	V1125A	probably damaging	Het
Ttn	A	G	2: 76,814,143	V4762A	possibly damaging	Het
Unc5d	A	G	8: 28,875,511	S149P	possibly damaging	Het
Usf3	A	T	16: 44,219,840	N1561I	probably damaging	Het
Wdr4	A	T	17: 31,501,298		probably benign	Het
Wdr49	T	G	3: 75,301,826	E612D	probably benign	Het

Other mutations in Cog4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01462:Cog4	APN	8	110866085	missense	probably benign	0.44
IGL01631:Cog4	APN	8	110881840	missense	probably damaging	1.00
IGL01756:Cog4	APN	8	110853759	nonsense	probably null
IGL02850:Cog4	APN	8	110866589	missense	possibly damaging	0.46
IGL02932:Cog4	APN	8	110852433	missense	probably benign	0.16
IGL03232:Cog4	APN	8	110880682	splice site	probably null
Deminimis	UTSW	8	110881480	missense	probably damaging	0.98
PIT4362001:Cog4	UTSW	8	110866672	missense	probably damaging	1.00
R0350:Cog4	UTSW	8	110853696	missense	possibly damaging	0.73
R1368:Cog4	UTSW	8	110858525	unclassified	probably benign
R1531:Cog4	UTSW	8	110879721	missense	probably benign	0.30
R2110:Cog4	UTSW	8	110858582	missense	possibly damaging	0.62
R2112:Cog4	UTSW	8	110858582	missense	possibly damaging	0.62
R2867:Cog4	UTSW	8	110866659	intron	probably benign
R4239:Cog4	UTSW	8	110858612	missense	probably damaging	0.98
R4867:Cog4	UTSW	8	110866610	missense	probably damaging	1.00
R4967:Cog4	UTSW	8	110852283	splice site	probably null
R5124:Cog4	UTSW	8	110847193	missense	probably damaging	1.00
R5655:Cog4	UTSW	8	110863307	missense	probably damaging	1.00
R6347:Cog4	UTSW	8	110880643	missense	probably damaging	1.00
R6475:Cog4	UTSW	8	110880894	missense	possibly damaging	0.74
R6526:Cog4	UTSW	8	110881786	missense	probably damaging	1.00
R6542:Cog4	UTSW	8	110851362	missense	probably damaging	1.00
R6545:Cog4	UTSW	8	110880945	missense	probably damaging	1.00
R7248:Cog4	UTSW	8	110882202	missense	unknown
R7292:Cog4	UTSW	8	110881828	missense	probably damaging	1.00
R7356:Cog4	UTSW	8	110849866	critical splice acceptor site	probably null
R7440:Cog4	UTSW	8	110879706	missense	probably benign	0.06
R7751:Cog4	UTSW	8	110880968	missense	probably damaging	1.00
Z1177:Cog4	UTSW	8	110879015	missense	not run

Predicted Primers

PCR Primer
(F):5'- AATCTAGACCCTGCTCTGGC -3'
(R):5'- GCTTTACTGAGACAAGGCAGAG -3'

Sequencing Primer
(F):5'- TCAGACTCAGACCATCGGGATTG -3'
(R):5'- CTTTACTGAGACAAGGCAGAGACATG -3'

Posted On

2017-06-26