Mutagenetix > Incidental Mutations

Incidental Mutation 'R6024:Pcnt'

479097

Institutional Source

Beutler Lab

Gene Symbol

Pcnt

Ensembl Gene

ENSMUSG00000001151

Gene Name

pericentrin (kendrin)

Synonyms

m239Asp, m275Asp, Pcnt2

MMRRC Submission

044196-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6024 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

76351263-76442786 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 76420037 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 790 (S790G)

Ref Sequence

ENSEMBL: ENSMUSP00000001179 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001179] [ENSMUST00000217838]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000001179
AA Change: S790G

PolyPhen 2 Score 0.866 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000001179
Gene: ENSMUSG00000001151
AA Change: S790G

Domain	Start	End	E-Value	Type
internal_repeat_1	7	78	2.47e-5	PROSPERO
low complexity region	104	114	N/A	INTRINSIC
coiled coil region	131	229	N/A	INTRINSIC
internal_repeat_3	241	259	6.69e-5	PROSPERO
low complexity region	313	325	N/A	INTRINSIC
internal_repeat_3	391	409	6.69e-5	PROSPERO
low complexity region	456	467	N/A	INTRINSIC
coiled coil region	468	520	N/A	INTRINSIC
coiled coil region	554	581	N/A	INTRINSIC
low complexity region	652	666	N/A	INTRINSIC
coiled coil region	727	787	N/A	INTRINSIC
coiled coil region	871	916	N/A	INTRINSIC
low complexity region	931	942	N/A	INTRINSIC
low complexity region	969	985	N/A	INTRINSIC
coiled coil region	1055	1383	N/A	INTRINSIC
coiled coil region	1429	1481	N/A	INTRINSIC
coiled coil region	1529	1567	N/A	INTRINSIC
low complexity region	1614	1624	N/A	INTRINSIC
internal_repeat_2	1916	1964	2.47e-5	PROSPERO
coiled coil region	2158	2178	N/A	INTRINSIC
coiled coil region	2211	2279	N/A	INTRINSIC
coiled coil region	2300	2421	N/A	INTRINSIC
coiled coil region	2447	2526	N/A	INTRINSIC
Pfam:PACT_coil_coil	2718	2797	5.8e-29	PFAM
internal_repeat_1	2820	2885	2.47e-5	PROSPERO
internal_repeat_2	2844	2891	2.47e-5	PROSPERO

Predicted Effect

probably benign
Transcript: ENSMUST00000217838
AA Change: S790G

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220395

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 93.0%

Validation Efficiency

100% (56/56)

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trapped allele display mitotic spindle misorientation, microcephaly, craniofacial developmental anomalies, such as cleft palate and eye defects, variable structural kidney and cardiovascular defects, and altered hemodynamics leading to heart failure and prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	A	G	13: 81,476,505	F3782L	probably benign	Het
Akr1d1	T	C	6: 37,558,482	I267T	probably benign	Het
Arhgef5	T	C	6: 43,275,134	S940P	probably benign	Het
Art2b	A	G	7: 101,580,380	I104T	probably benign	Het
Avpr1a	A	G	10: 122,449,148	Y115C	probably damaging	Het
Ccdc84	T	C	9: 44,417,952	T13A	possibly damaging	Het
Cdc42bpg	T	A	19: 6,317,496	L995Q	probably damaging	Het
Clip1	T	C	5: 123,615,089	K210E	possibly damaging	Het
Cog4	C	T	8: 110,881,480	T735I	probably damaging	Het
Creb3l4	G	A	3: 90,238,699	S206L	probably damaging	Het
Csf3r	C	A	4: 126,037,517		probably null	Het
Dnah11	G	T	12: 118,030,272	S2346R	probably benign	Het
Dnaic2	A	T	11: 114,752,908	I467F	possibly damaging	Het
Doxl2	A	T	6: 48,976,096	K318N	possibly damaging	Het
Dpy19l4	A	T	4: 11,276,876	M523K	probably damaging	Het
Ebf3	T	C	7: 137,200,535	D407G	probably damaging	Het
Fbn2	A	G	18: 58,076,836	I991T	probably benign	Het
Gcc1	T	C	6: 28,419,300	T345A	probably benign	Het
Gm1527	C	T	3: 28,920,603	H522Y	probably benign	Het
Gm340	C	A	19: 41,583,957	P384T	possibly damaging	Het
Gm4846	T	A	1: 166,490,127	Y240F	probably benign	Het
Hmgcl	T	C	4: 135,955,615	V126A	probably benign	Het
Ifit1bl2	G	T	19: 34,620,038	S59R	probably benign	Het
Itga6	A	G	2: 71,787,233	N32S	probably benign	Het
Macc1	T	C	12: 119,450,425	S779P	probably benign	Het
Mctp1	G	T	13: 76,385,161	L209F	probably damaging	Het
Mink1	A	G	11: 70,599,089	N97S	possibly damaging	Het
Mst1r	T	A	9: 107,908,151	V336E	probably benign	Het
Muc16	A	T	9: 18,646,671	S2775R	unknown	Het
Muc6	T	A	7: 141,641,574	T1316S	possibly damaging	Het
Myh11	T	A	16: 14,277,703	N65I	probably damaging	Het
Myo9a	A	G	9: 59,855,388	N801D	possibly damaging	Het
Nkain2	A	T	10: 31,951,285	M103K	probably damaging	Het
Nkx2-2	T	A	2: 147,184,041	Y259F	probably benign	Het
Nrxn1	T	C	17: 90,590,098	M877V	possibly damaging	Het
Nxf1	C	T	19: 8,767,744	L453F	probably damaging	Het
Phf3	T	C	1: 30,863,226	D2G	probably damaging	Het
Phrf1	T	C	7: 141,258,985		probably benign	Het
Ptpn3	C	A	4: 57,248,653		probably null	Het
Pygl	T	C	12: 70,197,067	T625A	probably benign	Het
R3hdm2	T	A	10: 127,459,480	F239I	probably damaging	Het
Sesn1	A	T	10: 41,896,200	I242F	probably damaging	Het
Shank2	C	T	7: 144,180,031	T105I	probably benign	Het
Skint3	T	C	4: 112,290,346	F350S	possibly damaging	Het
Slco5a1	T	C	1: 12,944,070	Y320C	probably damaging	Het
Syt11	A	G	3: 88,762,109	S159P	probably benign	Het
Tanc2	G	A	11: 105,867,717	R768Q	probably damaging	Het
Tanc2	T	C	11: 105,923,672	S1981P	probably damaging	Het
Tmem200c	A	C	17: 68,841,727	D435A	possibly damaging	Het
Trappc8	A	G	18: 20,833,009	V1125A	probably damaging	Het
Ttn	A	G	2: 76,814,143	V4762A	possibly damaging	Het
Unc5d	A	G	8: 28,875,511	S149P	possibly damaging	Het
Usf3	A	T	16: 44,219,840	N1561I	probably damaging	Het
Wdr4	A	T	17: 31,501,298		probably benign	Het
Wdr49	T	G	3: 75,301,826	E612D	probably benign	Het

Other mutations in Pcnt

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01075:Pcnt	APN	10	76422904	nonsense	probably null
IGL01307:Pcnt	APN	10	76411588	missense	probably damaging	1.00
IGL01549:Pcnt	APN	10	76367486	splice site	probably null
IGL01576:Pcnt	APN	10	76368822	missense	probably damaging	0.99
IGL01611:Pcnt	APN	10	76436424	critical splice donor site	probably null
IGL01630:Pcnt	APN	10	76420246	missense	probably damaging	0.99
IGL01647:Pcnt	APN	10	76370001	nonsense	probably null
IGL01689:Pcnt	APN	10	76411653	missense	probably damaging	1.00
IGL01690:Pcnt	APN	10	76392775	missense	probably damaging	1.00
IGL01723:Pcnt	APN	10	76418499	missense	possibly damaging	0.63
IGL01920:Pcnt	APN	10	76404528	missense	probably damaging	1.00
IGL01958:Pcnt	APN	10	76433679	missense	probably damaging	0.96
IGL02210:Pcnt	APN	10	76389219	missense	possibly damaging	0.95
IGL02225:Pcnt	APN	10	76389474	missense	probably benign	0.00
IGL02228:Pcnt	APN	10	76389474	missense	probably benign	0.00
IGL02237:Pcnt	APN	10	76352984	missense	probably damaging	1.00
IGL02279:Pcnt	APN	10	76403765	missense	probably damaging	1.00
IGL02303:Pcnt	APN	10	76442559	splice site	probably benign
IGL02355:Pcnt	APN	10	76375162	nonsense	probably null
IGL02362:Pcnt	APN	10	76375162	nonsense	probably null
IGL02428:Pcnt	APN	10	76429256	missense	probably damaging	0.99
IGL02536:Pcnt	APN	10	76380229	missense	possibly damaging	0.68
IGL02715:Pcnt	APN	10	76368722	splice site	probably benign
IGL02800:Pcnt	APN	10	76412583	nonsense	probably null
IGL03395:Pcnt	APN	10	76436491	missense	possibly damaging	0.95
IGL02799:Pcnt	UTSW	10	76412583	nonsense	probably null
PIT4520001:Pcnt	UTSW	10	76420235	missense	probably damaging	0.99
R0049:Pcnt	UTSW	10	76369821	unclassified	probably benign
R0049:Pcnt	UTSW	10	76369821	unclassified	probably benign
R0109:Pcnt	UTSW	10	76389196	missense	probably benign	0.00
R0117:Pcnt	UTSW	10	76408727	nonsense	probably null
R0254:Pcnt	UTSW	10	76392580	missense	probably benign	0.10
R0392:Pcnt	UTSW	10	76384826	missense	probably benign
R0511:Pcnt	UTSW	10	76404595	missense	possibly damaging	0.66
R0570:Pcnt	UTSW	10	76412107	missense	probably damaging	1.00
R0614:Pcnt	UTSW	10	76420316	missense	probably damaging	1.00
R0635:Pcnt	UTSW	10	76404585	missense	probably damaging	1.00
R0707:Pcnt	UTSW	10	76420541	missense	probably damaging	1.00
R0749:Pcnt	UTSW	10	76381364	missense	probably damaging	1.00
R0969:Pcnt	UTSW	10	76427951	missense	probably damaging	1.00
R1172:Pcnt	UTSW	10	76393044	splice site	probably null
R1174:Pcnt	UTSW	10	76393044	splice site	probably null
R1175:Pcnt	UTSW	10	76393044	splice site	probably null
R1512:Pcnt	UTSW	10	76404662	splice site	probably null
R1542:Pcnt	UTSW	10	76389387	missense	probably benign	0.08
R1542:Pcnt	UTSW	10	76401386	missense	probably benign	0.02
R1558:Pcnt	UTSW	10	76422922	missense	possibly damaging	0.53
R1562:Pcnt	UTSW	10	76367330	missense	probably benign	0.02
R1762:Pcnt	UTSW	10	76355137	critical splice acceptor site	probably null
R1779:Pcnt	UTSW	10	76408796	missense	probably damaging	0.99
R1869:Pcnt	UTSW	10	76379906	missense	probably null	0.94
R1911:Pcnt	UTSW	10	76368816	missense	possibly damaging	0.94
R1985:Pcnt	UTSW	10	76380337	missense	possibly damaging	0.95
R1995:Pcnt	UTSW	10	76392799	nonsense	probably null
R2073:Pcnt	UTSW	10	76380380	missense	possibly damaging	0.92
R2111:Pcnt	UTSW	10	76420526	missense	probably damaging	0.99
R2112:Pcnt	UTSW	10	76420526	missense	probably damaging	0.99
R2309:Pcnt	UTSW	10	76442626	start gained	probably benign
R2902:Pcnt	UTSW	10	76375230	missense	probably damaging	0.98
R3623:Pcnt	UTSW	10	76433750	missense	probably benign	0.23
R4088:Pcnt	UTSW	10	76428014	missense	probably damaging	1.00
R4300:Pcnt	UTSW	10	76367391	missense	probably benign	0.40
R4402:Pcnt	UTSW	10	76392393	missense	probably benign	0.00
R4407:Pcnt	UTSW	10	76374870	missense	possibly damaging	0.90
R4483:Pcnt	UTSW	10	76401483	missense	probably damaging	1.00
R4647:Pcnt	UTSW	10	76354213	missense	probably benign	0.01
R4734:Pcnt	UTSW	10	76437206	missense	probably benign	0.25
R4747:Pcnt	UTSW	10	76436465	missense	possibly damaging	0.91
R4782:Pcnt	UTSW	10	76409577	missense	possibly damaging	0.62
R4795:Pcnt	UTSW	10	76370024	missense	probably benign	0.21
R4831:Pcnt	UTSW	10	76412501	missense	probably damaging	0.96
R4873:Pcnt	UTSW	10	76369854	missense	probably benign	0.03
R4875:Pcnt	UTSW	10	76369854	missense	probably benign	0.03
R4946:Pcnt	UTSW	10	76356185	missense	probably damaging	1.00
R5032:Pcnt	UTSW	10	76355077	missense	probably benign	0.00
R5033:Pcnt	UTSW	10	76399945	missense	possibly damaging	0.95
R5106:Pcnt	UTSW	10	76401444	missense	probably damaging	1.00
R5118:Pcnt	UTSW	10	76412168	missense	probably damaging	0.98
R5167:Pcnt	UTSW	10	76420424	missense	probably damaging	0.97
R5199:Pcnt	UTSW	10	76418544	missense	probably benign	0.09
R5223:Pcnt	UTSW	10	76380272	missense	probably damaging	0.99
R5241:Pcnt	UTSW	10	76433617	missense	probably benign	0.26
R5308:Pcnt	UTSW	10	76356325	nonsense	probably null
R5328:Pcnt	UTSW	10	76411719	missense	probably damaging	1.00
R5454:Pcnt	UTSW	10	76389547	splice site	probably null
R5543:Pcnt	UTSW	10	76412052	missense	probably benign	0.01
R5588:Pcnt	UTSW	10	76442611	missense	possibly damaging	0.74
R5647:Pcnt	UTSW	10	76385841	missense	probably benign	0.17
R5668:Pcnt	UTSW	10	76409500	missense	probably benign	0.16
R5712:Pcnt	UTSW	10	76429271	missense	probably damaging	0.96
R5714:Pcnt	UTSW	10	76420491	missense	probably damaging	1.00
R5797:Pcnt	UTSW	10	76392756	missense	probably benign	0.00
R5946:Pcnt	UTSW	10	76382063	missense	possibly damaging	0.91
R5955:Pcnt	UTSW	10	76411622	missense	possibly damaging	0.45
R6267:Pcnt	UTSW	10	76385798	missense	probably benign	0.02
R6485:Pcnt	UTSW	10	76389330	nonsense	probably null
R6605:Pcnt	UTSW	10	76429198	critical splice donor site	probably null
R6877:Pcnt	UTSW	10	76434017	missense	possibly damaging	0.94
R6882:Pcnt	UTSW	10	76427828	missense	probably benign	0.00
R6919:Pcnt	UTSW	10	76385798	missense	probably benign	0.02
R7025:Pcnt	UTSW	10	76403835	missense	probably damaging	1.00
R7098:Pcnt	UTSW	10	76384839	missense	probably benign
R7109:Pcnt	UTSW	10	76369904	missense	probably damaging	1.00
R7121:Pcnt	UTSW	10	76427927	missense	possibly damaging	0.73
R7143:Pcnt	UTSW	10	76389060	missense	possibly damaging	0.47
R7152:Pcnt	UTSW	10	76411360	splice site	probably null
R7213:Pcnt	UTSW	10	76408904	missense	probably damaging	1.00
R7368:Pcnt	UTSW	10	76400001	missense	probably benign
R7453:Pcnt	UTSW	10	76389450	missense	probably benign
R7486:Pcnt	UTSW	10	76418436	missense	probably benign	0.03
R7486:Pcnt	UTSW	10	76418437	missense	probably benign
R7538:Pcnt	UTSW	10	76399939	missense	probably benign
R7575:Pcnt	UTSW	10	76389252	missense	probably benign	0.32
R7662:Pcnt	UTSW	10	76387522	missense	probably benign	0.27
R7685:Pcnt	UTSW	10	76422808	missense	probably benign	0.14
R7764:Pcnt	UTSW	10	76354248	missense	probably benign	0.33
R7802:Pcnt	UTSW	10	76375303	splice site	probably null
R8432:Pcnt	UTSW	10	76420205	missense	probably damaging	1.00
R8439:Pcnt	UTSW	10	76420205	missense	probably damaging	1.00
R8493:Pcnt	UTSW	10	76403623	critical splice donor site	probably null
R8530:Pcnt	UTSW	10	76420205	missense	probably damaging	1.00
R8535:Pcnt	UTSW	10	76420205	missense	probably damaging	1.00
Z1176:Pcnt	UTSW	10	76382157	nonsense	probably null
Z1177:Pcnt	UTSW	10	76399968	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CAACTCTCTGTGAGGCTCAG -3'
(R):5'- TTCGGGATGAGCACCAACAG -3'

Sequencing Primer
(F):5'- CTCTGTGAGGCTCAGATACAC -3'
(R):5'- TGAGCACCAACAGGCTTTG -3'

Posted On

2017-06-26