Incidental Mutation 'R6024:Tanc2'
ID479101
Institutional Source Beutler Lab
Gene Symbol Tanc2
Ensembl Gene ENSMUSG00000053580
Gene Nametetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
Synonyms5730590C14Rik, 3526402J09Rik
MMRRC Submission 044196-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6024 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location105589986-105929304 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 105867717 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 768 (R768Q)
Ref Sequence ENSEMBL: ENSMUSP00000097904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100330]
Predicted Effect probably damaging
Transcript: ENSMUST00000100330
AA Change: R768Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097904
Gene: ENSMUSG00000053580
AA Change: R768Q

DomainStartEndE-ValueType
low complexity region 32 50 N/A INTRINSIC
low complexity region 129 152 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
low complexity region 436 447 N/A INTRINSIC
low complexity region 823 834 N/A INTRINSIC
ANK 846 878 2.08e3 SMART
ANK 882 913 2.97e2 SMART
ANK 917 946 5.75e-1 SMART
ANK 950 979 8.62e1 SMART
ANK 990 1018 1.16e3 SMART
ANK 1033 1062 3.31e-1 SMART
ANK 1066 1095 7.71e-2 SMART
ANK 1099 1128 6.12e-5 SMART
ANK 1132 1161 8.99e-3 SMART
ANK 1165 1194 5.71e-5 SMART
ANK 1198 1227 2.11e2 SMART
TPR 1244 1277 3.89e1 SMART
TPR 1291 1324 3.61e-2 SMART
TPR 1325 1358 2.82e-4 SMART
low complexity region 1369 1406 N/A INTRINSIC
low complexity region 1533 1539 N/A INTRINSIC
low complexity region 1787 1802 N/A INTRINSIC
Meta Mutation Damage Score 0.1170 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap vector die prior to E12. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A G 13: 81,476,505 F3782L probably benign Het
Akr1d1 T C 6: 37,558,482 I267T probably benign Het
Arhgef5 T C 6: 43,275,134 S940P probably benign Het
Art2b A G 7: 101,580,380 I104T probably benign Het
Avpr1a A G 10: 122,449,148 Y115C probably damaging Het
Ccdc84 T C 9: 44,417,952 T13A possibly damaging Het
Cdc42bpg T A 19: 6,317,496 L995Q probably damaging Het
Clip1 T C 5: 123,615,089 K210E possibly damaging Het
Cog4 C T 8: 110,881,480 T735I probably damaging Het
Creb3l4 G A 3: 90,238,699 S206L probably damaging Het
Csf3r C A 4: 126,037,517 probably null Het
Dnah11 G T 12: 118,030,272 S2346R probably benign Het
Dnaic2 A T 11: 114,752,908 I467F possibly damaging Het
Doxl2 A T 6: 48,976,096 K318N possibly damaging Het
Dpy19l4 A T 4: 11,276,876 M523K probably damaging Het
Ebf3 T C 7: 137,200,535 D407G probably damaging Het
Fbn2 A G 18: 58,076,836 I991T probably benign Het
Gcc1 T C 6: 28,419,300 T345A probably benign Het
Gm1527 C T 3: 28,920,603 H522Y probably benign Het
Gm340 C A 19: 41,583,957 P384T possibly damaging Het
Gm4846 T A 1: 166,490,127 Y240F probably benign Het
Hmgcl T C 4: 135,955,615 V126A probably benign Het
Ifit1bl2 G T 19: 34,620,038 S59R probably benign Het
Itga6 A G 2: 71,787,233 N32S probably benign Het
Macc1 T C 12: 119,450,425 S779P probably benign Het
Mctp1 G T 13: 76,385,161 L209F probably damaging Het
Mink1 A G 11: 70,599,089 N97S possibly damaging Het
Mst1r T A 9: 107,908,151 V336E probably benign Het
Muc16 A T 9: 18,646,671 S2775R unknown Het
Muc6 T A 7: 141,641,574 T1316S possibly damaging Het
Myh11 T A 16: 14,277,703 N65I probably damaging Het
Myo9a A G 9: 59,855,388 N801D possibly damaging Het
Nkain2 A T 10: 31,951,285 M103K probably damaging Het
Nkx2-2 T A 2: 147,184,041 Y259F probably benign Het
Nrxn1 T C 17: 90,590,098 M877V possibly damaging Het
Nxf1 C T 19: 8,767,744 L453F probably damaging Het
Pcnt T C 10: 76,420,037 S790G possibly damaging Het
Phf3 T C 1: 30,863,226 D2G probably damaging Het
Phrf1 T C 7: 141,258,985 probably benign Het
Ptpn3 C A 4: 57,248,653 probably null Het
Pygl T C 12: 70,197,067 T625A probably benign Het
R3hdm2 T A 10: 127,459,480 F239I probably damaging Het
Sesn1 A T 10: 41,896,200 I242F probably damaging Het
Shank2 C T 7: 144,180,031 T105I probably benign Het
Skint3 T C 4: 112,290,346 F350S possibly damaging Het
Slco5a1 T C 1: 12,944,070 Y320C probably damaging Het
Syt11 A G 3: 88,762,109 S159P probably benign Het
Tmem200c A C 17: 68,841,727 D435A possibly damaging Het
Trappc8 A G 18: 20,833,009 V1125A probably damaging Het
Ttn A G 2: 76,814,143 V4762A possibly damaging Het
Unc5d A G 8: 28,875,511 S149P possibly damaging Het
Usf3 A T 16: 44,219,840 N1561I probably damaging Het
Wdr4 A T 17: 31,501,298 probably benign Het
Wdr49 T G 3: 75,301,826 E612D probably benign Het
Other mutations in Tanc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Tanc2 APN 11 105923220 missense probably benign 0.28
IGL00688:Tanc2 APN 11 105798690 missense probably damaging 1.00
IGL00709:Tanc2 APN 11 105798795 missense probably damaging 1.00
IGL01013:Tanc2 APN 11 105625065 missense probably damaging 0.96
IGL01141:Tanc2 APN 11 105886474 splice site probably benign
IGL01386:Tanc2 APN 11 105886381 missense probably damaging 0.99
IGL01433:Tanc2 APN 11 105810522 missense possibly damaging 0.75
IGL01562:Tanc2 APN 11 105780069 missense probably benign 0.00
IGL01979:Tanc2 APN 11 105776920 missense probably benign
IGL02104:Tanc2 APN 11 105780133 unclassified probably benign
IGL02434:Tanc2 APN 11 105780042 missense probably benign 0.14
IGL02534:Tanc2 APN 11 105835168 missense probably damaging 1.00
IGL02568:Tanc2 APN 11 105776951 missense probably benign 0.00
IGL03279:Tanc2 APN 11 105913092 splice site probably null
R0595:Tanc2 UTSW 11 105714177 splice site probably null
R1131:Tanc2 UTSW 11 105835002 missense probably damaging 1.00
R1320:Tanc2 UTSW 11 105886444 missense probably damaging 1.00
R1487:Tanc2 UTSW 11 105923634 missense probably damaging 0.99
R1497:Tanc2 UTSW 11 105922137 missense probably benign 0.21
R1692:Tanc2 UTSW 11 105857500 missense probably benign
R1712:Tanc2 UTSW 11 105899780 missense probably benign
R1793:Tanc2 UTSW 11 105625033 critical splice acceptor site probably null
R1812:Tanc2 UTSW 11 105886386 missense probably benign 0.01
R1905:Tanc2 UTSW 11 105922863 missense possibly damaging 0.61
R1959:Tanc2 UTSW 11 105910295 missense probably damaging 1.00
R1962:Tanc2 UTSW 11 105798732 missense probably benign 0.14
R2122:Tanc2 UTSW 11 105895949 missense probably damaging 1.00
R2174:Tanc2 UTSW 11 105910309 missense probably benign 0.00
R2341:Tanc2 UTSW 11 105835051 missense probably benign 0.09
R2497:Tanc2 UTSW 11 105673493 critical splice donor site probably null
R3438:Tanc2 UTSW 11 105857575 missense probably damaging 0.97
R3711:Tanc2 UTSW 11 105798690 missense probably damaging 1.00
R3765:Tanc2 UTSW 11 105914970 missense probably damaging 1.00
R3890:Tanc2 UTSW 11 105798678 missense probably damaging 1.00
R4193:Tanc2 UTSW 11 105914062 intron probably benign
R4609:Tanc2 UTSW 11 105910240 missense probably benign 0.24
R4674:Tanc2 UTSW 11 105867480 missense probably damaging 1.00
R4928:Tanc2 UTSW 11 105867762 missense probably damaging 1.00
R5008:Tanc2 UTSW 11 105625060 start codon destroyed probably null 0.46
R5010:Tanc2 UTSW 11 105780092 missense probably damaging 1.00
R5135:Tanc2 UTSW 11 105857553 missense possibly damaging 0.93
R5385:Tanc2 UTSW 11 105776846 missense probably damaging 0.99
R5409:Tanc2 UTSW 11 105867485 missense possibly damaging 0.93
R5419:Tanc2 UTSW 11 105922883 missense probably benign 0.00
R5501:Tanc2 UTSW 11 105914985 critical splice donor site probably null
R5590:Tanc2 UTSW 11 105923306 missense probably damaging 0.99
R5651:Tanc2 UTSW 11 105798700 missense probably benign 0.44
R5798:Tanc2 UTSW 11 105921855 small deletion probably benign
R5876:Tanc2 UTSW 11 105922613 missense possibly damaging 0.71
R5889:Tanc2 UTSW 11 105921807 missense probably benign 0.23
R5958:Tanc2 UTSW 11 105840625 missense probably benign 0.00
R5999:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6024:Tanc2 UTSW 11 105923672 missense probably damaging 1.00
R6025:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6025:Tanc2 UTSW 11 105896547 missense possibly damaging 0.68
R6048:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6049:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6185:Tanc2 UTSW 11 105913039 missense probably damaging 1.00
R6335:Tanc2 UTSW 11 105857556 missense probably damaging 0.99
R6821:Tanc2 UTSW 11 105886490 intron probably null
R6846:Tanc2 UTSW 11 105798653 missense probably benign 0.34
R6857:Tanc2 UTSW 11 105910288 missense possibly damaging 0.81
R6904:Tanc2 UTSW 11 105835230 missense possibly damaging 0.89
R7009:Tanc2 UTSW 11 105840699 missense possibly damaging 0.47
R7017:Tanc2 UTSW 11 105923108 missense probably benign
R7371:Tanc2 UTSW 11 105798596 missense probably benign
R7556:Tanc2 UTSW 11 105909031 missense
R7630:Tanc2 UTSW 11 105776908 missense probably benign 0.04
R7693:Tanc2 UTSW 11 105923467 missense probably damaging 1.00
R7757:Tanc2 UTSW 11 105776858 missense possibly damaging 0.81
R7807:Tanc2 UTSW 11 105867654 missense probably benign 0.00
R7878:Tanc2 UTSW 11 105913415 missense
R7895:Tanc2 UTSW 11 105921825 missense probably damaging 1.00
R7961:Tanc2 UTSW 11 105913415 missense
R7978:Tanc2 UTSW 11 105921825 missense probably damaging 1.00
X0027:Tanc2 UTSW 11 105835183 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TCTCCTGAATGTGGCAGTAGC -3'
(R):5'- GCACTGCTAAACTTGCAGCC -3'

Sequencing Primer
(F):5'- GCAGTAGCCTCTCTCCACC -3'
(R):5'- TGCAGAGAAAAATCTCCTCTGTGG -3'
Posted On2017-06-26