Mutagenetix > Incidental Mutations

Incidental Mutation 'R6024:Tanc2'

479101

Institutional Source

Beutler Lab

Gene Symbol

Tanc2

Ensembl Gene

ENSMUSG00000053580

Gene Name

tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2

Synonyms

5730590C14Rik, 3526402J09Rik

MMRRC Submission

044196-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6024 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

105589986-105929304 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 105867717 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 768 (R768Q)

Ref Sequence

ENSEMBL: ENSMUSP00000097904 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100330]

Predicted Effect

probably damaging
Transcript: ENSMUST00000100330
AA Change: R768Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097904
Gene: ENSMUSG00000053580
AA Change: R768Q

Domain	Start	End	E-Value	Type
low complexity region	32	50	N/A	INTRINSIC
low complexity region	129	152	N/A	INTRINSIC
low complexity region	362	375	N/A	INTRINSIC
low complexity region	436	447	N/A	INTRINSIC
low complexity region	823	834	N/A	INTRINSIC
ANK	846	878	2.08e3	SMART
ANK	882	913	2.97e2	SMART
ANK	917	946	5.75e-1	SMART
ANK	950	979	8.62e1	SMART
ANK	990	1018	1.16e3	SMART
ANK	1033	1062	3.31e-1	SMART
ANK	1066	1095	7.71e-2	SMART
ANK	1099	1128	6.12e-5	SMART
ANK	1132	1161	8.99e-3	SMART
ANK	1165	1194	5.71e-5	SMART
ANK	1198	1227	2.11e2	SMART
TPR	1244	1277	3.89e1	SMART
TPR	1291	1324	3.61e-2	SMART
TPR	1325	1358	2.82e-4	SMART
low complexity region	1369	1406	N/A	INTRINSIC
low complexity region	1533	1539	N/A	INTRINSIC
low complexity region	1787	1802	N/A	INTRINSIC

Meta Mutation Damage Score

0.1170

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 93.0%

Validation Efficiency

100% (56/56)

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trap vector die prior to E12. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	A	G	13: 81,476,505	F3782L	probably benign	Het
Akr1d1	T	C	6: 37,558,482	I267T	probably benign	Het
Arhgef5	T	C	6: 43,275,134	S940P	probably benign	Het
Art2b	A	G	7: 101,580,380	I104T	probably benign	Het
Avpr1a	A	G	10: 122,449,148	Y115C	probably damaging	Het
Ccdc84	T	C	9: 44,417,952	T13A	possibly damaging	Het
Cdc42bpg	T	A	19: 6,317,496	L995Q	probably damaging	Het
Clip1	T	C	5: 123,615,089	K210E	possibly damaging	Het
Cog4	C	T	8: 110,881,480	T735I	probably damaging	Het
Creb3l4	G	A	3: 90,238,699	S206L	probably damaging	Het
Csf3r	C	A	4: 126,037,517		probably null	Het
Dnah11	G	T	12: 118,030,272	S2346R	probably benign	Het
Dnaic2	A	T	11: 114,752,908	I467F	possibly damaging	Het
Doxl2	A	T	6: 48,976,096	K318N	possibly damaging	Het
Dpy19l4	A	T	4: 11,276,876	M523K	probably damaging	Het
Ebf3	T	C	7: 137,200,535	D407G	probably damaging	Het
Fbn2	A	G	18: 58,076,836	I991T	probably benign	Het
Gcc1	T	C	6: 28,419,300	T345A	probably benign	Het
Gm1527	C	T	3: 28,920,603	H522Y	probably benign	Het
Gm340	C	A	19: 41,583,957	P384T	possibly damaging	Het
Gm4846	T	A	1: 166,490,127	Y240F	probably benign	Het
Hmgcl	T	C	4: 135,955,615	V126A	probably benign	Het
Ifit1bl2	G	T	19: 34,620,038	S59R	probably benign	Het
Itga6	A	G	2: 71,787,233	N32S	probably benign	Het
Macc1	T	C	12: 119,450,425	S779P	probably benign	Het
Mctp1	G	T	13: 76,385,161	L209F	probably damaging	Het
Mink1	A	G	11: 70,599,089	N97S	possibly damaging	Het
Mst1r	T	A	9: 107,908,151	V336E	probably benign	Het
Muc16	A	T	9: 18,646,671	S2775R	unknown	Het
Muc6	T	A	7: 141,641,574	T1316S	possibly damaging	Het
Myh11	T	A	16: 14,277,703	N65I	probably damaging	Het
Myo9a	A	G	9: 59,855,388	N801D	possibly damaging	Het
Nkain2	A	T	10: 31,951,285	M103K	probably damaging	Het
Nkx2-2	T	A	2: 147,184,041	Y259F	probably benign	Het
Nrxn1	T	C	17: 90,590,098	M877V	possibly damaging	Het
Nxf1	C	T	19: 8,767,744	L453F	probably damaging	Het
Pcnt	T	C	10: 76,420,037	S790G	possibly damaging	Het
Phf3	T	C	1: 30,863,226	D2G	probably damaging	Het
Phrf1	T	C	7: 141,258,985		probably benign	Het
Ptpn3	C	A	4: 57,248,653		probably null	Het
Pygl	T	C	12: 70,197,067	T625A	probably benign	Het
R3hdm2	T	A	10: 127,459,480	F239I	probably damaging	Het
Sesn1	A	T	10: 41,896,200	I242F	probably damaging	Het
Shank2	C	T	7: 144,180,031	T105I	probably benign	Het
Skint3	T	C	4: 112,290,346	F350S	possibly damaging	Het
Slco5a1	T	C	1: 12,944,070	Y320C	probably damaging	Het
Syt11	A	G	3: 88,762,109	S159P	probably benign	Het
Tmem200c	A	C	17: 68,841,727	D435A	possibly damaging	Het
Trappc8	A	G	18: 20,833,009	V1125A	probably damaging	Het
Ttn	A	G	2: 76,814,143	V4762A	possibly damaging	Het
Unc5d	A	G	8: 28,875,511	S149P	possibly damaging	Het
Usf3	A	T	16: 44,219,840	N1561I	probably damaging	Het
Wdr4	A	T	17: 31,501,298		probably benign	Het
Wdr49	T	G	3: 75,301,826	E612D	probably benign	Het

Other mutations in Tanc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00501:Tanc2	APN	11	105923220	missense	probably benign	0.28
IGL00688:Tanc2	APN	11	105798690	missense	probably damaging	1.00
IGL00709:Tanc2	APN	11	105798795	missense	probably damaging	1.00
IGL01013:Tanc2	APN	11	105625065	missense	probably damaging	0.96
IGL01141:Tanc2	APN	11	105886474	splice site	probably benign
IGL01386:Tanc2	APN	11	105886381	missense	probably damaging	0.99
IGL01433:Tanc2	APN	11	105810522	missense	possibly damaging	0.75
IGL01562:Tanc2	APN	11	105780069	missense	probably benign	0.00
IGL01979:Tanc2	APN	11	105776920	missense	probably benign
IGL02104:Tanc2	APN	11	105780133	unclassified	probably benign
IGL02434:Tanc2	APN	11	105780042	missense	probably benign	0.14
IGL02534:Tanc2	APN	11	105835168	missense	probably damaging	1.00
IGL02568:Tanc2	APN	11	105776951	missense	probably benign	0.00
IGL03279:Tanc2	APN	11	105913092	splice site	probably null
R0595:Tanc2	UTSW	11	105714177	splice site	probably null
R1131:Tanc2	UTSW	11	105835002	missense	probably damaging	1.00
R1320:Tanc2	UTSW	11	105886444	missense	probably damaging	1.00
R1487:Tanc2	UTSW	11	105923634	missense	probably damaging	0.99
R1497:Tanc2	UTSW	11	105922137	missense	probably benign	0.21
R1692:Tanc2	UTSW	11	105857500	missense	probably benign
R1712:Tanc2	UTSW	11	105899780	missense	probably benign
R1793:Tanc2	UTSW	11	105625033	critical splice acceptor site	probably null
R1812:Tanc2	UTSW	11	105886386	missense	probably benign	0.01
R1905:Tanc2	UTSW	11	105922863	missense	possibly damaging	0.61
R1959:Tanc2	UTSW	11	105910295	missense	probably damaging	1.00
R1962:Tanc2	UTSW	11	105798732	missense	probably benign	0.14
R2122:Tanc2	UTSW	11	105895949	missense	probably damaging	1.00
R2174:Tanc2	UTSW	11	105910309	missense	probably benign	0.00
R2341:Tanc2	UTSW	11	105835051	missense	probably benign	0.09
R2497:Tanc2	UTSW	11	105673493	critical splice donor site	probably null
R3438:Tanc2	UTSW	11	105857575	missense	probably damaging	0.97
R3711:Tanc2	UTSW	11	105798690	missense	probably damaging	1.00
R3765:Tanc2	UTSW	11	105914970	missense	probably damaging	1.00
R3890:Tanc2	UTSW	11	105798678	missense	probably damaging	1.00
R4193:Tanc2	UTSW	11	105914062	intron	probably benign
R4609:Tanc2	UTSW	11	105910240	missense	probably benign	0.24
R4674:Tanc2	UTSW	11	105867480	missense	probably damaging	1.00
R4928:Tanc2	UTSW	11	105867762	missense	probably damaging	1.00
R5008:Tanc2	UTSW	11	105625060	start codon destroyed	probably null	0.46
R5010:Tanc2	UTSW	11	105780092	missense	probably damaging	1.00
R5135:Tanc2	UTSW	11	105857553	missense	possibly damaging	0.93
R5385:Tanc2	UTSW	11	105776846	missense	probably damaging	0.99
R5409:Tanc2	UTSW	11	105867485	missense	possibly damaging	0.93
R5419:Tanc2	UTSW	11	105922883	missense	probably benign	0.00
R5501:Tanc2	UTSW	11	105914985	critical splice donor site	probably null
R5590:Tanc2	UTSW	11	105923306	missense	probably damaging	0.99
R5651:Tanc2	UTSW	11	105798700	missense	probably benign	0.44
R5798:Tanc2	UTSW	11	105921855	small deletion	probably benign
R5876:Tanc2	UTSW	11	105922613	missense	possibly damaging	0.71
R5889:Tanc2	UTSW	11	105921807	missense	probably benign	0.23
R5958:Tanc2	UTSW	11	105840625	missense	probably benign	0.00
R5999:Tanc2	UTSW	11	105867717	missense	probably damaging	1.00
R6024:Tanc2	UTSW	11	105923672	missense	probably damaging	1.00
R6025:Tanc2	UTSW	11	105867717	missense	probably damaging	1.00
R6025:Tanc2	UTSW	11	105896547	missense	possibly damaging	0.68
R6048:Tanc2	UTSW	11	105867717	missense	probably damaging	1.00
R6049:Tanc2	UTSW	11	105867717	missense	probably damaging	1.00
R6185:Tanc2	UTSW	11	105913039	missense	probably damaging	1.00
R6335:Tanc2	UTSW	11	105857556	missense	probably damaging	0.99
R6821:Tanc2	UTSW	11	105886490	intron	probably null
R6846:Tanc2	UTSW	11	105798653	missense	probably benign	0.34
R6857:Tanc2	UTSW	11	105910288	missense	possibly damaging	0.81
R6904:Tanc2	UTSW	11	105835230	missense	possibly damaging	0.89
R7009:Tanc2	UTSW	11	105840699	missense	possibly damaging	0.47
R7017:Tanc2	UTSW	11	105923108	missense	probably benign
R7371:Tanc2	UTSW	11	105798596	missense	probably benign
R7556:Tanc2	UTSW	11	105909031	missense
R7630:Tanc2	UTSW	11	105776908	missense	probably benign	0.04
R7693:Tanc2	UTSW	11	105923467	missense	probably damaging	1.00
R7757:Tanc2	UTSW	11	105776858	missense	possibly damaging	0.81
R7807:Tanc2	UTSW	11	105867654	missense	probably benign	0.00
R7878:Tanc2	UTSW	11	105913415	missense
R7895:Tanc2	UTSW	11	105921825	missense	probably damaging	1.00
R7961:Tanc2	UTSW	11	105913415	missense
R7978:Tanc2	UTSW	11	105921825	missense	probably damaging	1.00
X0027:Tanc2	UTSW	11	105835183	missense	probably benign	0.26

Predicted Primers

PCR Primer
(F):5'- TCTCCTGAATGTGGCAGTAGC -3'
(R):5'- GCACTGCTAAACTTGCAGCC -3'

Sequencing Primer
(F):5'- GCAGTAGCCTCTCTCCACC -3'
(R):5'- TGCAGAGAAAAATCTCCTCTGTGG -3'

Posted On

2017-06-26