Mutagenetix > Incidental Mutation

Incidental Mutation 'R6024:Pygl'

479104

Institutional Source

Beutler Lab

Gene Symbol

Pygl

Ensembl Gene

ENSMUSG00000021069

Gene Name

liver glycogen phosphorylase

Synonyms

MMRRC Submission

044196-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.387) question?

Stock #

R6024 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70190811-70231488 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 70197067 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 625 (T625A)

Ref Sequence

ENSEMBL: ENSMUSP00000071231 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071250] [ENSMUST00000161083]

AlphaFold

Q9ET01

Predicted Effect

probably benign
Transcript: ENSMUST00000071250
AA Change: T625A

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000071231
Gene: ENSMUSG00000021069
AA Change: T625A

Domain	Start	End	E-Value	Type
Pfam:Phosphorylase	113	829	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000161083
AA Change: T534A

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000125585
Gene: ENSMUSG00000021069
AA Change: T534A

Domain	Start	End	E-Value	Type
Pfam:Phosphorylase	21	739	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162613

Meta Mutation Damage Score

0.3779

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 93.0%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homodimeric protein that catalyses the cleavage of alpha-1,4-glucosidic bonds to release glucose-1-phosphate from liver glycogen stores. This protein switches from inactive phosphorylase B to active phosphorylase A by phosphorylation of serine residue 15. Activity of this enzyme is further regulated by multiple allosteric effectors and hormonal controls. Humans have three glycogen phosphorylase genes that encode distinct isozymes that are primarily expressed in liver, brain and muscle, respectively. The liver isozyme serves the glycemic demands of the body in general while the brain and muscle isozymes supply just those tissues. In glycogen storage disease type VI, also known as Hers disease, mutations in liver glycogen phosphorylase inhibit the conversion of glycogen to glucose and results in moderate hypoglycemia, mild ketosis, growth retardation and hepatomegaly. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Feb 2011]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	A	G	13: 81,476,505	F3782L	probably benign	Het
Akr1d1	T	C	6: 37,558,482	I267T	probably benign	Het
Arhgef5	T	C	6: 43,275,134	S940P	probably benign	Het
Art2b	A	G	7: 101,580,380	I104T	probably benign	Het
Avpr1a	A	G	10: 122,449,148	Y115C	probably damaging	Het
Ccdc84	T	C	9: 44,417,952	T13A	possibly damaging	Het
Cdc42bpg	T	A	19: 6,317,496	L995Q	probably damaging	Het
Clip1	T	C	5: 123,615,089	K210E	possibly damaging	Het
Cog4	C	T	8: 110,881,480	T735I	probably damaging	Het
Creb3l4	G	A	3: 90,238,699	S206L	probably damaging	Het
Csf3r	C	A	4: 126,037,517		probably null	Het
Dnah11	G	T	12: 118,030,272	S2346R	probably benign	Het
Dnaic2	A	T	11: 114,752,908	I467F	possibly damaging	Het
Doxl2	A	T	6: 48,976,096	K318N	possibly damaging	Het
Dpy19l4	A	T	4: 11,276,876	M523K	probably damaging	Het
Ebf3	T	C	7: 137,200,535	D407G	probably damaging	Het
Fbn2	A	G	18: 58,076,836	I991T	probably benign	Het
Gcc1	T	C	6: 28,419,300	T345A	probably benign	Het
Gm1527	C	T	3: 28,920,603	H522Y	probably benign	Het
Gm340	C	A	19: 41,583,957	P384T	possibly damaging	Het
Gm4846	T	A	1: 166,490,127	Y240F	probably benign	Het
Hmgcl	T	C	4: 135,955,615	V126A	probably benign	Het
Ifit1bl2	G	T	19: 34,620,038	S59R	probably benign	Het
Itga6	A	G	2: 71,787,233	N32S	probably benign	Het
Macc1	T	C	12: 119,450,425	S779P	probably benign	Het
Mctp1	G	T	13: 76,385,161	L209F	probably damaging	Het
Mink1	A	G	11: 70,599,089	N97S	possibly damaging	Het
Mst1r	T	A	9: 107,908,151	V336E	probably benign	Het
Muc16	A	T	9: 18,646,671	S2775R	unknown	Het
Muc6	T	A	7: 141,641,574	T1316S	possibly damaging	Het
Myh11	T	A	16: 14,277,703	N65I	probably damaging	Het
Myo9a	A	G	9: 59,855,388	N801D	possibly damaging	Het
Nkain2	A	T	10: 31,951,285	M103K	probably damaging	Het
Nkx2-2	T	A	2: 147,184,041	Y259F	probably benign	Het
Nrxn1	T	C	17: 90,590,098	M877V	possibly damaging	Het
Nxf1	C	T	19: 8,767,744	L453F	probably damaging	Het
Pcnt	T	C	10: 76,420,037	S790G	possibly damaging	Het
Phf3	T	C	1: 30,863,226	D2G	probably damaging	Het
Phrf1	T	C	7: 141,258,985		probably benign	Het
Ptpn3	C	A	4: 57,248,653		probably null	Het
R3hdm2	T	A	10: 127,459,480	F239I	probably damaging	Het
Sesn1	A	T	10: 41,896,200	I242F	probably damaging	Het
Shank2	C	T	7: 144,180,031	T105I	probably benign	Het
Skint3	T	C	4: 112,290,346	F350S	possibly damaging	Het
Slco5a1	T	C	1: 12,944,070	Y320C	probably damaging	Het
Syt11	A	G	3: 88,762,109	S159P	probably benign	Het
Tanc2	G	A	11: 105,867,717	R768Q	probably damaging	Het
Tanc2	T	C	11: 105,923,672	S1981P	probably damaging	Het
Tmem200c	A	C	17: 68,841,727	D435A	possibly damaging	Het
Trappc8	A	G	18: 20,833,009	V1125A	probably damaging	Het
Ttn	A	G	2: 76,814,143	V4762A	possibly damaging	Het
Unc5d	A	G	8: 28,875,511	S149P	possibly damaging	Het
Usf3	A	T	16: 44,219,840	N1561I	probably damaging	Het
Wdr4	A	T	17: 31,501,298		probably benign	Het
Wdr49	T	G	3: 75,301,826	E612D	probably benign	Het

Other mutations in Pygl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Pygl	APN	12	70191092	missense	probably damaging	1.00
IGL00903:Pygl	APN	12	70207742	missense	probably damaging	1.00
IGL01965:Pygl	APN	12	70191114	missense	probably benign	0.00
IGL02347:Pygl	APN	12	70201892	missense	probably benign	0.14
IGL02403:Pygl	APN	12	70194258	missense	probably benign
IGL02501:Pygl	APN	12	70191134	missense	probably benign	0.05
IGL02727:Pygl	APN	12	70207668	splice site	probably null
IGL03125:Pygl	APN	12	70197482	missense	probably damaging	1.00
IGL03158:Pygl	APN	12	70195675	missense	probably damaging	1.00
IGL03202:Pygl	APN	12	70199646	missense	probably benign
IGL03368:Pygl	APN	12	70191152	missense	probably benign
R0096:Pygl	UTSW	12	70191166	splice site	probably benign
R0096:Pygl	UTSW	12	70191166	splice site	probably benign
R0524:Pygl	UTSW	12	70207724	missense	probably damaging	1.00
R0883:Pygl	UTSW	12	70206404	missense	probably damaging	0.97
R0894:Pygl	UTSW	12	70194374	splice site	probably benign
R0905:Pygl	UTSW	12	70211017	splice site	probably benign
R1494:Pygl	UTSW	12	70199730	missense	probably damaging	0.98
R1621:Pygl	UTSW	12	70191092	missense	probably damaging	1.00
R1647:Pygl	UTSW	12	70197010	missense	possibly damaging	0.60
R3082:Pygl	UTSW	12	70197529	missense	probably damaging	1.00
R3845:Pygl	UTSW	12	70198443	missense	probably benign	0.12
R3876:Pygl	UTSW	12	70201339	missense	probably damaging	1.00
R4358:Pygl	UTSW	12	70195690	missense	probably damaging	1.00
R4614:Pygl	UTSW	12	70210979	splice site	probably null
R4707:Pygl	UTSW	12	70207758	missense	possibly damaging	0.69
R4908:Pygl	UTSW	12	70197033	missense	probably null
R4940:Pygl	UTSW	12	70206381	missense	probably damaging	1.00
R5077:Pygl	UTSW	12	70201892	missense	probably benign	0.14
R5186:Pygl	UTSW	12	70201344	missense	probably damaging	1.00
R5726:Pygl	UTSW	12	70191142	nonsense	probably null
R5953:Pygl	UTSW	12	70219627	missense	probably damaging	1.00
R5957:Pygl	UTSW	12	70199720	missense	probably damaging	0.99
R6020:Pygl	UTSW	12	70216654	missense	probably damaging	1.00
R7050:Pygl	UTSW	12	70219622	missense	probably damaging	1.00
R7159:Pygl	UTSW	12	70197406	missense	probably benign	0.41
R7194:Pygl	UTSW	12	70194320	missense	probably benign
R7283:Pygl	UTSW	12	70216568	missense	possibly damaging	0.92
R7360:Pygl	UTSW	12	70227532	missense	probably benign	0.11
R7446:Pygl	UTSW	12	70197010	missense	probably benign
R7637:Pygl	UTSW	12	70197795	splice site	probably null
R7886:Pygl	UTSW	12	70206356	splice site	probably null
R8054:Pygl	UTSW	12	70227339	critical splice donor site	probably null
R8693:Pygl	UTSW	12	70197406	missense	probably benign	0.41
R8753:Pygl	UTSW	12	70195626	missense	probably damaging	1.00
R8803:Pygl	UTSW	12	70195616	missense	probably damaging	1.00
R8842:Pygl	UTSW	12	70227594	intron	probably benign
R9192:Pygl	UTSW	12	70197048	missense	probably damaging	0.99
R9221:Pygl	UTSW	12	70195627	missense	probably damaging	1.00
R9437:Pygl	UTSW	12	70200151	missense	probably damaging	1.00
R9750:Pygl	UTSW	12	70198529	missense	possibly damaging	0.68
Z1176:Pygl	UTSW	12	70222874	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- ACTTGGGCCATTGTAGAAGCC -3'
(R):5'- AGGACAGTCATAATTGGTGGC -3'

Sequencing Primer
(F):5'- GGCCATTGTAGAAGCCATCTTAG -3'
(R):5'- GCAAAGTAAGTTGGCTGAATTTC -3'

Posted On

2017-06-26