Incidental Mutation 'R6024:Ifit1bl2'
ID479117
Institutional Source Beutler Lab
Gene Symbol Ifit1bl2
Ensembl Gene ENSMUSG00000067297
Gene Nameinterferon induced protein with tetratricopeptide repeats 1B like 2
Synonyms2010002M12Rik
MMRRC Submission 044196-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6024 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location34617049-34640743 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 34620038 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 59 (S59R)
Ref Sequence ENSEMBL: ENSMUSP00000108082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087357] [ENSMUST00000112463]
Predicted Effect probably benign
Transcript: ENSMUST00000087357
AA Change: S59R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000093816
Gene: ENSMUSG00000067297
AA Change: S59R

DomainStartEndE-ValueType
TPR 60 93 2.92e1 SMART
TPR 100 133 6.24e1 SMART
TPR 144 179 4.32e1 SMART
low complexity region 217 230 N/A INTRINSIC
TPR 249 282 2.24e1 SMART
TPR 334 367 4.55e1 SMART
low complexity region 411 421 N/A INTRINSIC
TPR 429 462 1.45e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112463
AA Change: S59R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000108082
Gene: ENSMUSG00000067297
AA Change: S59R

DomainStartEndE-ValueType
TPR 60 93 2.92e1 SMART
TPR 100 133 6.24e1 SMART
TPR 144 179 4.32e1 SMART
low complexity region 217 230 N/A INTRINSIC
TPR 249 282 2.24e1 SMART
TPR 334 367 4.55e1 SMART
low complexity region 411 421 N/A INTRINSIC
TPR 429 462 1.45e-1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A G 13: 81,476,505 F3782L probably benign Het
Akr1d1 T C 6: 37,558,482 I267T probably benign Het
Arhgef5 T C 6: 43,275,134 S940P probably benign Het
Art2b A G 7: 101,580,380 I104T probably benign Het
Avpr1a A G 10: 122,449,148 Y115C probably damaging Het
Ccdc84 T C 9: 44,417,952 T13A possibly damaging Het
Cdc42bpg T A 19: 6,317,496 L995Q probably damaging Het
Clip1 T C 5: 123,615,089 K210E possibly damaging Het
Cog4 C T 8: 110,881,480 T735I probably damaging Het
Creb3l4 G A 3: 90,238,699 S206L probably damaging Het
Csf3r C A 4: 126,037,517 probably null Het
Dnah11 G T 12: 118,030,272 S2346R probably benign Het
Dnaic2 A T 11: 114,752,908 I467F possibly damaging Het
Doxl2 A T 6: 48,976,096 K318N possibly damaging Het
Dpy19l4 A T 4: 11,276,876 M523K probably damaging Het
Ebf3 T C 7: 137,200,535 D407G probably damaging Het
Fbn2 A G 18: 58,076,836 I991T probably benign Het
Gcc1 T C 6: 28,419,300 T345A probably benign Het
Gm1527 C T 3: 28,920,603 H522Y probably benign Het
Gm340 C A 19: 41,583,957 P384T possibly damaging Het
Gm4846 T A 1: 166,490,127 Y240F probably benign Het
Hmgcl T C 4: 135,955,615 V126A probably benign Het
Itga6 A G 2: 71,787,233 N32S probably benign Het
Macc1 T C 12: 119,450,425 S779P probably benign Het
Mctp1 G T 13: 76,385,161 L209F probably damaging Het
Mink1 A G 11: 70,599,089 N97S possibly damaging Het
Mst1r T A 9: 107,908,151 V336E probably benign Het
Muc16 A T 9: 18,646,671 S2775R unknown Het
Muc6 T A 7: 141,641,574 T1316S possibly damaging Het
Myh11 T A 16: 14,277,703 N65I probably damaging Het
Myo9a A G 9: 59,855,388 N801D possibly damaging Het
Nkain2 A T 10: 31,951,285 M103K probably damaging Het
Nkx2-2 T A 2: 147,184,041 Y259F probably benign Het
Nrxn1 T C 17: 90,590,098 M877V possibly damaging Het
Nxf1 C T 19: 8,767,744 L453F probably damaging Het
Pcnt T C 10: 76,420,037 S790G possibly damaging Het
Phf3 T C 1: 30,863,226 D2G probably damaging Het
Phrf1 T C 7: 141,258,985 probably benign Het
Ptpn3 C A 4: 57,248,653 probably null Het
Pygl T C 12: 70,197,067 T625A probably benign Het
R3hdm2 T A 10: 127,459,480 F239I probably damaging Het
Sesn1 A T 10: 41,896,200 I242F probably damaging Het
Shank2 C T 7: 144,180,031 T105I probably benign Het
Skint3 T C 4: 112,290,346 F350S possibly damaging Het
Slco5a1 T C 1: 12,944,070 Y320C probably damaging Het
Syt11 A G 3: 88,762,109 S159P probably benign Het
Tanc2 G A 11: 105,867,717 R768Q probably damaging Het
Tanc2 T C 11: 105,923,672 S1981P probably damaging Het
Tmem200c A C 17: 68,841,727 D435A possibly damaging Het
Trappc8 A G 18: 20,833,009 V1125A probably damaging Het
Ttn A G 2: 76,814,143 V4762A possibly damaging Het
Unc5d A G 8: 28,875,511 S149P possibly damaging Het
Usf3 A T 16: 44,219,840 N1561I probably damaging Het
Wdr4 A T 17: 31,501,298 probably benign Het
Wdr49 T G 3: 75,301,826 E612D probably benign Het
Other mutations in Ifit1bl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ifit1bl2 APN 19 34619919 missense probably benign 0.22
IGL00706:Ifit1bl2 APN 19 34618882 missense probably benign 0.09
IGL01322:Ifit1bl2 APN 19 34619004 missense probably benign 0.10
IGL01362:Ifit1bl2 APN 19 34619484 missense probably benign 0.04
IGL03061:Ifit1bl2 APN 19 34619724 missense probably benign 0.41
R0039:Ifit1bl2 UTSW 19 34619446 nonsense probably null
R1079:Ifit1bl2 UTSW 19 34619485 missense probably benign 0.00
R1438:Ifit1bl2 UTSW 19 34619169 missense possibly damaging 0.70
R2050:Ifit1bl2 UTSW 19 34619470 missense possibly damaging 0.75
R2104:Ifit1bl2 UTSW 19 34619520 missense probably benign 0.01
R2228:Ifit1bl2 UTSW 19 34619230 missense possibly damaging 0.70
R2229:Ifit1bl2 UTSW 19 34619230 missense possibly damaging 0.70
R4468:Ifit1bl2 UTSW 19 34619068 nonsense probably null
R4517:Ifit1bl2 UTSW 19 34629764 start gained probably benign
R5723:Ifit1bl2 UTSW 19 34620058 missense probably benign 0.07
R5935:Ifit1bl2 UTSW 19 34619728 missense probably benign 0.04
R6083:Ifit1bl2 UTSW 19 34619817 missense possibly damaging 0.80
R6085:Ifit1bl2 UTSW 19 34619817 missense possibly damaging 0.80
R6280:Ifit1bl2 UTSW 19 34620134 missense possibly damaging 0.70
R6368:Ifit1bl2 UTSW 19 34619125 missense probably benign 0.00
R6905:Ifit1bl2 UTSW 19 34619590 missense possibly damaging 0.90
R7048:Ifit1bl2 UTSW 19 34619151 missense probably benign 0.04
R7355:Ifit1bl2 UTSW 19 34619661 missense probably damaging 1.00
R7447:Ifit1bl2 UTSW 19 34619574 missense probably damaging 1.00
R7661:Ifit1bl2 UTSW 19 34619028 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGCTGCCCCTGTGGTAATG -3'
(R):5'- AGGGTATATGGTGACTTAGAACACTGG -3'

Sequencing Primer
(F):5'- TGTGGTAATGCAGCCAGGC -3'
(R):5'- CACTGGTTGATTCCTAGTACACAG -3'
Posted On2017-06-26