Incidental Mutation 'R6024:Gm340'
ID479118
Institutional Source Beutler Lab
Gene Symbol Gm340
Ensembl Gene ENSMUSG00000090673
Gene Namepredicted gene 340
SynonymsLOC381224
MMRRC Submission 044196-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R6024 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location41582370-41586536 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 41583957 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 384 (P384T)
Ref Sequence ENSEMBL: ENSMUSP00000128083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172371]
Predicted Effect possibly damaging
Transcript: ENSMUST00000172371
AA Change: P384T

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128083
Gene: ENSMUSG00000090673
AA Change: P384T

DomainStartEndE-ValueType
low complexity region 10 17 N/A INTRINSIC
low complexity region 438 450 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
low complexity region 768 779 N/A INTRINSIC
Pfam:DUF4553 787 1241 9.7e-179 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183602
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A G 13: 81,476,505 F3782L probably benign Het
Akr1d1 T C 6: 37,558,482 I267T probably benign Het
Arhgef5 T C 6: 43,275,134 S940P probably benign Het
Art2b A G 7: 101,580,380 I104T probably benign Het
Avpr1a A G 10: 122,449,148 Y115C probably damaging Het
Ccdc84 T C 9: 44,417,952 T13A possibly damaging Het
Cdc42bpg T A 19: 6,317,496 L995Q probably damaging Het
Clip1 T C 5: 123,615,089 K210E possibly damaging Het
Cog4 C T 8: 110,881,480 T735I probably damaging Het
Creb3l4 G A 3: 90,238,699 S206L probably damaging Het
Csf3r C A 4: 126,037,517 probably null Het
Dnah11 G T 12: 118,030,272 S2346R probably benign Het
Dnaic2 A T 11: 114,752,908 I467F possibly damaging Het
Doxl2 A T 6: 48,976,096 K318N possibly damaging Het
Dpy19l4 A T 4: 11,276,876 M523K probably damaging Het
Ebf3 T C 7: 137,200,535 D407G probably damaging Het
Fbn2 A G 18: 58,076,836 I991T probably benign Het
Gcc1 T C 6: 28,419,300 T345A probably benign Het
Gm1527 C T 3: 28,920,603 H522Y probably benign Het
Gm4846 T A 1: 166,490,127 Y240F probably benign Het
Hmgcl T C 4: 135,955,615 V126A probably benign Het
Ifit1bl2 G T 19: 34,620,038 S59R probably benign Het
Itga6 A G 2: 71,787,233 N32S probably benign Het
Macc1 T C 12: 119,450,425 S779P probably benign Het
Mctp1 G T 13: 76,385,161 L209F probably damaging Het
Mink1 A G 11: 70,599,089 N97S possibly damaging Het
Mst1r T A 9: 107,908,151 V336E probably benign Het
Muc16 A T 9: 18,646,671 S2775R unknown Het
Muc6 T A 7: 141,641,574 T1316S possibly damaging Het
Myh11 T A 16: 14,277,703 N65I probably damaging Het
Myo9a A G 9: 59,855,388 N801D possibly damaging Het
Nkain2 A T 10: 31,951,285 M103K probably damaging Het
Nkx2-2 T A 2: 147,184,041 Y259F probably benign Het
Nrxn1 T C 17: 90,590,098 M877V possibly damaging Het
Nxf1 C T 19: 8,767,744 L453F probably damaging Het
Pcnt T C 10: 76,420,037 S790G possibly damaging Het
Phf3 T C 1: 30,863,226 D2G probably damaging Het
Phrf1 T C 7: 141,258,985 probably benign Het
Ptpn3 C A 4: 57,248,653 probably null Het
Pygl T C 12: 70,197,067 T625A probably benign Het
R3hdm2 T A 10: 127,459,480 F239I probably damaging Het
Sesn1 A T 10: 41,896,200 I242F probably damaging Het
Shank2 C T 7: 144,180,031 T105I probably benign Het
Skint3 T C 4: 112,290,346 F350S possibly damaging Het
Slco5a1 T C 1: 12,944,070 Y320C probably damaging Het
Syt11 A G 3: 88,762,109 S159P probably benign Het
Tanc2 G A 11: 105,867,717 R768Q probably damaging Het
Tanc2 T C 11: 105,923,672 S1981P probably damaging Het
Tmem200c A C 17: 68,841,727 D435A possibly damaging Het
Trappc8 A G 18: 20,833,009 V1125A probably damaging Het
Ttn A G 2: 76,814,143 V4762A possibly damaging Het
Unc5d A G 8: 28,875,511 S149P possibly damaging Het
Usf3 A T 16: 44,219,840 N1561I probably damaging Het
Wdr4 A T 17: 31,501,298 probably benign Het
Wdr49 T G 3: 75,301,826 E612D probably benign Het
Other mutations in Gm340
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB003:Gm340 UTSW 19 41582569 missense probably benign
BB013:Gm340 UTSW 19 41582569 missense probably benign
R0006:Gm340 UTSW 19 41584899 missense probably benign 0.00
R0686:Gm340 UTSW 19 41582372 missense possibly damaging 0.73
R1104:Gm340 UTSW 19 41586063 missense probably damaging 0.99
R1278:Gm340 UTSW 19 41584683 missense probably benign 0.07
R1606:Gm340 UTSW 19 41585074 missense probably benign 0.35
R1833:Gm340 UTSW 19 41584948 missense probably benign 0.00
R1905:Gm340 UTSW 19 41583574 missense possibly damaging 0.73
R2697:Gm340 UTSW 19 41584027 missense probably benign 0.43
R2881:Gm340 UTSW 19 41583049 missense probably damaging 1.00
R4720:Gm340 UTSW 19 41585895 missense probably benign 0.04
R4864:Gm340 UTSW 19 41585364 missense probably benign
R4908:Gm340 UTSW 19 41584162 missense probably benign 0.00
R5193:Gm340 UTSW 19 41582530 missense probably damaging 1.00
R5215:Gm340 UTSW 19 41585932 missense probably damaging 1.00
R5276:Gm340 UTSW 19 41585039 missense probably damaging 0.98
R5319:Gm340 UTSW 19 41586352 missense probably damaging 0.99
R5321:Gm340 UTSW 19 41585204 missense probably damaging 1.00
R5432:Gm340 UTSW 19 41584603 missense probably damaging 1.00
R5605:Gm340 UTSW 19 41582863 missense probably damaging 1.00
R5941:Gm340 UTSW 19 41586400 missense probably damaging 1.00
R6020:Gm340 UTSW 19 41583547 missense possibly damaging 0.88
R6149:Gm340 UTSW 19 41585202 missense probably damaging 1.00
R6260:Gm340 UTSW 19 41582370 missense probably null 0.91
R6260:Gm340 UTSW 19 41582371 missense possibly damaging 0.73
R6476:Gm340 UTSW 19 41583079 missense probably benign 0.04
R7051:Gm340 UTSW 19 41585752 missense probably benign 0.05
R7285:Gm340 UTSW 19 41584315 missense possibly damaging 0.91
R7372:Gm340 UTSW 19 41585506 missense probably damaging 1.00
R7762:Gm340 UTSW 19 41583667 missense probably benign 0.02
R7833:Gm340 UTSW 19 41584585 missense probably benign 0.02
R7926:Gm340 UTSW 19 41582569 missense probably benign
R8164:Gm340 UTSW 19 41585410 missense probably damaging 1.00
R8319:Gm340 UTSW 19 41582904 missense probably damaging 1.00
R8323:Gm340 UTSW 19 41583597 missense probably benign 0.01
R8327:Gm340 UTSW 19 41582557 missense probably damaging 1.00
R8423:Gm340 UTSW 19 41585449 missense possibly damaging 0.95
X0013:Gm340 UTSW 19 41584532 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGCAGCATTGTGGTCTCAC -3'
(R):5'- TGGGTTCTCATCAGTGACAATGC -3'

Sequencing Primer
(F):5'- GGTCTCACCTCCCACAGAAAGTG -3'
(R):5'- AGTGACAATGCTGCTCTCCAG -3'
Posted On2017-06-26