Incidental Mutation 'R6035:Itga8'
ID 479123
Institutional Source Beutler Lab
Gene Symbol Itga8
Ensembl Gene ENSMUSG00000026768
Gene Name integrin alpha 8
Synonyms
MMRRC Submission 044207-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.870) question?
Stock # R6035 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 12111443-12306733 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 12196525 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 631 (T631A)
Ref Sequence ENSEMBL: ENSMUSP00000028106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]
AlphaFold A2ARA8
Predicted Effect probably benign
Transcript: ENSMUST00000028106
AA Change: T631A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768
AA Change: T631A

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
SCOP:d1m1xa2 643 780 2e-46 SMART
SCOP:d1m1xa3 784 1000 2e-80 SMART
transmembrane domain 1011 1033 N/A INTRINSIC
Pfam:Integrin_alpha 1034 1048 2.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129370
Predicted Effect probably benign
Transcript: ENSMUST00000172791
SMART Domains Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 98.9%
  • 10x: 91.8%
  • 20x: 70.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m G T 6: 121,615,353 (GRCm39) G76W probably damaging Het
Abca17 A T 17: 24,500,219 (GRCm39) F1324Y possibly damaging Het
Abca8b A T 11: 109,862,686 (GRCm39) probably null Het
Abcc12 A G 8: 87,244,033 (GRCm39) M1040T probably damaging Het
Abtb1 A G 6: 88,818,788 (GRCm39) F7L probably damaging Het
Adcy9 T C 16: 4,122,377 (GRCm39) T558A probably benign Het
Adgrb1 A T 15: 74,412,292 (GRCm39) T424S possibly damaging Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Ankrd31 C A 13: 96,968,721 (GRCm39) P786Q probably benign Het
Arhgap39 G T 15: 76,621,424 (GRCm39) Y392* probably null Het
Ash1l T C 3: 88,892,326 (GRCm39) Y1402H probably damaging Het
Carmil2 G T 8: 106,419,195 (GRCm39) W749L probably benign Het
Ccar1 A G 10: 62,587,564 (GRCm39) Y867H unknown Het
Cdh13 A G 8: 119,232,437 (GRCm39) D47G probably benign Het
Chst9 T A 18: 15,585,910 (GRCm39) T218S probably benign Het
Clec2i G A 6: 128,870,587 (GRCm39) V67I probably benign Het
Cox7a2 T A 9: 79,667,028 (GRCm39) probably benign Het
Cplx3 A G 9: 57,519,030 (GRCm39) probably null Het
Cpz A G 5: 35,674,929 (GRCm39) C107R probably damaging Het
Dapk1 T A 13: 60,909,013 (GRCm39) C1209S possibly damaging Het
Ddx41 T C 13: 55,681,781 (GRCm39) M307V probably benign Het
Defa24 A G 8: 22,224,565 (GRCm39) I5V probably benign Het
Dgcr8 A T 16: 18,076,178 (GRCm39) N2K probably damaging Het
Ebf2 A G 14: 67,476,423 (GRCm39) D131G probably damaging Het
Fam149b C T 14: 20,427,985 (GRCm39) R424C probably damaging Het
Fbln2 G A 6: 91,240,335 (GRCm39) V714M probably damaging Het
Fgf5 T C 5: 98,423,385 (GRCm39) Y257H probably damaging Het
Fmo3 A C 1: 162,791,605 (GRCm39) V224G probably damaging Het
Gigyf2 T C 1: 87,338,450 (GRCm39) I394T possibly damaging Het
Glmn T A 5: 107,741,746 (GRCm39) probably null Het
Greb1l T C 18: 10,501,025 (GRCm39) I385T possibly damaging Het
Grhl1 C A 12: 24,658,449 (GRCm39) Q365K probably benign Het
Gsdme G A 6: 50,206,306 (GRCm39) T179M probably damaging Het
Gtf2a1l A G 17: 89,018,962 (GRCm39) T349A probably benign Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,905,247 (GRCm39) probably benign Het
Il5ra G A 6: 106,718,226 (GRCm39) T76I probably damaging Het
Kcnh6 G A 11: 105,909,978 (GRCm39) probably null Het
Krt26 C T 11: 99,224,415 (GRCm39) E368K probably benign Het
Lhx9 T C 1: 138,766,281 (GRCm39) D169G possibly damaging Het
Lmod3 A G 6: 97,224,234 (GRCm39) L529P probably damaging Het
Mroh2a G A 1: 88,158,390 (GRCm39) V146M probably damaging Het
Nup155 A G 15: 8,173,577 (GRCm39) T891A probably benign Het
Or11g24 A G 14: 50,661,984 (GRCm39) T3A probably benign Het
Or1e1 T C 11: 73,244,582 (GRCm39) M1T probably null Het
Or1j13 T A 2: 36,369,996 (GRCm39) I49F probably damaging Het
Or1p4-ps1 T C 11: 74,208,285 (GRCm39) *145R probably null Het
Or8b36 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 37,937,836 (GRCm39) probably null Het
Papln G C 12: 83,821,454 (GRCm39) G262A probably damaging Het
Pdcd1lg2 G A 19: 29,423,435 (GRCm39) V160I probably benign Het
Pde8b A G 13: 95,164,105 (GRCm39) probably benign Het
Ppme1 G A 7: 100,004,002 (GRCm39) R68* probably null Het
Ptprn2 A T 12: 117,219,215 (GRCm39) N949Y probably damaging Het
Qser1 C A 2: 104,617,468 (GRCm39) D1115Y probably damaging Het
Rad54l G T 4: 115,954,666 (GRCm39) D674E probably damaging Het
Ripk4 T A 16: 97,545,387 (GRCm39) D420V probably damaging Het
Ros1 G T 10: 51,954,067 (GRCm39) S1857R probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Rsf1 A G 7: 97,311,316 (GRCm39) E682G probably benign Het
Samd4 G A 14: 47,325,329 (GRCm39) R515H probably damaging Het
Selp T A 1: 163,969,079 (GRCm39) W560R probably benign Het
Shc3 A T 13: 51,615,468 (GRCm39) L163Q probably damaging Het
Shh G A 5: 28,666,397 (GRCm39) A163V probably damaging Het
Slc17a8 T C 10: 89,427,937 (GRCm39) R113G possibly damaging Het
Slc5a6 C A 5: 31,206,168 (GRCm39) probably benign Het
Smarcd2 A G 11: 106,157,715 (GRCm39) probably null Het
Sytl3 A G 17: 6,995,664 (GRCm39) D148G probably damaging Het
Tnks G T 8: 35,385,615 (GRCm39) H297Q possibly damaging Het
Trbv21 A T 6: 41,179,568 (GRCm39) probably benign Het
Ube3c T C 5: 29,806,161 (GRCm39) F268L probably benign Het
Ugt2b5 T C 5: 87,287,541 (GRCm39) I209V probably benign Het
Usp1 A G 4: 98,818,082 (GRCm39) N140S probably damaging Het
Vcam1 T C 3: 115,919,606 (GRCm39) Y226C probably damaging Het
Vmn1r129 T A 7: 21,094,534 (GRCm39) Q228L probably damaging Het
Vmn1r209 T A 13: 22,990,202 (GRCm39) N163Y probably benign Het
Vmn1r85 A G 7: 12,818,854 (GRCm39) S97P probably damaging Het
Vmn2r30 C T 7: 7,337,350 (GRCm39) M95I probably benign Het
Vmn2r74 G A 7: 85,601,098 (GRCm39) R847C probably damaging Het
Wdr70 G A 15: 7,916,830 (GRCm39) T529I possibly damaging Het
Zfp532 T G 18: 65,757,005 (GRCm39) S313A possibly damaging Het
Zhx3 A T 2: 160,621,463 (GRCm39) N901K probably benign Het
Other mutations in Itga8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Itga8 APN 2 12,260,777 (GRCm39) nonsense probably null
IGL00820:Itga8 APN 2 12,237,703 (GRCm39) missense possibly damaging 0.85
IGL01409:Itga8 APN 2 12,196,525 (GRCm39) missense probably benign
IGL01508:Itga8 APN 2 12,237,613 (GRCm39) missense possibly damaging 0.67
IGL01585:Itga8 APN 2 12,165,123 (GRCm39) splice site probably benign
IGL01590:Itga8 APN 2 12,165,144 (GRCm39) missense probably damaging 1.00
IGL01743:Itga8 APN 2 12,270,144 (GRCm39) missense probably benign 0.04
IGL02634:Itga8 APN 2 12,145,289 (GRCm39) missense possibly damaging 0.55
IGL02805:Itga8 APN 2 12,194,291 (GRCm39) missense possibly damaging 0.83
IGL03200:Itga8 APN 2 12,196,010 (GRCm39) missense probably benign 0.00
IGL03218:Itga8 APN 2 12,115,836 (GRCm39) missense possibly damaging 0.77
IGL03248:Itga8 APN 2 12,137,327 (GRCm39) missense probably benign 0.20
PIT4576001:Itga8 UTSW 2 12,234,903 (GRCm39) missense probably benign 0.19
R0196:Itga8 UTSW 2 12,209,540 (GRCm39) critical splice donor site probably null
R0356:Itga8 UTSW 2 12,187,532 (GRCm39) missense possibly damaging 0.73
R0466:Itga8 UTSW 2 12,237,697 (GRCm39) missense probably damaging 1.00
R0530:Itga8 UTSW 2 12,196,627 (GRCm39) missense probably damaging 0.99
R0715:Itga8 UTSW 2 12,196,053 (GRCm39) splice site probably benign
R0800:Itga8 UTSW 2 12,198,362 (GRCm39) missense possibly damaging 0.95
R0881:Itga8 UTSW 2 12,267,003 (GRCm39) splice site probably null
R1675:Itga8 UTSW 2 12,204,974 (GRCm39) missense probably damaging 0.99
R1758:Itga8 UTSW 2 12,270,144 (GRCm39) missense possibly damaging 0.83
R1939:Itga8 UTSW 2 12,305,657 (GRCm39) missense probably damaging 1.00
R2187:Itga8 UTSW 2 12,199,231 (GRCm39) missense possibly damaging 0.60
R2295:Itga8 UTSW 2 12,187,520 (GRCm39) missense probably benign 0.38
R2356:Itga8 UTSW 2 12,204,952 (GRCm39) missense probably benign
R2371:Itga8 UTSW 2 12,258,277 (GRCm39) missense probably damaging 1.00
R2412:Itga8 UTSW 2 12,306,526 (GRCm39) missense probably benign
R2440:Itga8 UTSW 2 12,183,491 (GRCm39) missense possibly damaging 0.70
R2848:Itga8 UTSW 2 12,165,215 (GRCm39) missense probably damaging 0.98
R3730:Itga8 UTSW 2 12,198,321 (GRCm39) missense possibly damaging 0.92
R3933:Itga8 UTSW 2 12,194,330 (GRCm39) missense probably benign
R3982:Itga8 UTSW 2 12,305,774 (GRCm39) missense possibly damaging 0.92
R4513:Itga8 UTSW 2 12,187,547 (GRCm39) missense probably benign 0.01
R4514:Itga8 UTSW 2 12,187,547 (GRCm39) missense probably benign 0.01
R4660:Itga8 UTSW 2 12,270,069 (GRCm39) missense probably damaging 1.00
R4890:Itga8 UTSW 2 12,198,102 (GRCm39) splice site probably benign
R5533:Itga8 UTSW 2 12,165,161 (GRCm39) missense possibly damaging 0.90
R5619:Itga8 UTSW 2 12,270,139 (GRCm39) missense probably damaging 1.00
R5720:Itga8 UTSW 2 12,115,898 (GRCm39) missense probably damaging 0.99
R5749:Itga8 UTSW 2 12,266,889 (GRCm39) missense probably damaging 1.00
R5930:Itga8 UTSW 2 12,235,019 (GRCm39) missense possibly damaging 0.84
R5954:Itga8 UTSW 2 12,137,297 (GRCm39) missense probably damaging 0.99
R6035:Itga8 UTSW 2 12,196,525 (GRCm39) missense probably benign
R6211:Itga8 UTSW 2 12,198,320 (GRCm39) missense probably damaging 1.00
R6337:Itga8 UTSW 2 12,258,280 (GRCm39) nonsense probably null
R6442:Itga8 UTSW 2 12,234,954 (GRCm39) missense probably benign 0.00
R6491:Itga8 UTSW 2 12,209,587 (GRCm39) missense probably damaging 1.00
R6543:Itga8 UTSW 2 12,306,455 (GRCm39) missense probably damaging 0.99
R6574:Itga8 UTSW 2 12,234,972 (GRCm39) missense probably benign 0.17
R6760:Itga8 UTSW 2 12,306,451 (GRCm39) missense probably damaging 1.00
R6858:Itga8 UTSW 2 12,204,892 (GRCm39) missense probably benign 0.00
R6943:Itga8 UTSW 2 12,160,182 (GRCm39) critical splice donor site probably null
R7048:Itga8 UTSW 2 12,115,895 (GRCm39) missense probably damaging 0.99
R7203:Itga8 UTSW 2 12,234,906 (GRCm39) missense possibly damaging 0.77
R7266:Itga8 UTSW 2 12,237,712 (GRCm39) missense probably damaging 1.00
R7323:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R7540:Itga8 UTSW 2 12,115,848 (GRCm39) missense possibly damaging 0.82
R7637:Itga8 UTSW 2 12,113,998 (GRCm39) missense probably damaging 1.00
R7748:Itga8 UTSW 2 12,235,050 (GRCm39) missense possibly damaging 0.80
R7848:Itga8 UTSW 2 12,196,548 (GRCm39) missense probably damaging 0.99
R8031:Itga8 UTSW 2 12,160,297 (GRCm39) missense probably benign
R8077:Itga8 UTSW 2 12,247,244 (GRCm39) missense probably benign 0.09
R8757:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R8759:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R8772:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8773:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8774:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8774-TAIL:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8775:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8775-TAIL:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8808:Itga8 UTSW 2 12,137,328 (GRCm39) nonsense probably null
R8898:Itga8 UTSW 2 12,145,206 (GRCm39) missense probably benign 0.05
R8962:Itga8 UTSW 2 12,196,045 (GRCm39) missense possibly damaging 0.94
R9056:Itga8 UTSW 2 12,235,019 (GRCm39) missense possibly damaging 0.84
R9155:Itga8 UTSW 2 12,194,330 (GRCm39) missense probably benign
R9354:Itga8 UTSW 2 12,237,668 (GRCm39) missense possibly damaging 0.94
R9563:Itga8 UTSW 2 12,165,219 (GRCm39) missense possibly damaging 0.83
R9589:Itga8 UTSW 2 12,237,701 (GRCm39) missense probably damaging 1.00
R9663:Itga8 UTSW 2 12,196,580 (GRCm39) missense probably benign 0.00
Z1176:Itga8 UTSW 2 12,306,643 (GRCm39) start gained probably benign
Z1176:Itga8 UTSW 2 12,266,947 (GRCm39) missense probably benign 0.01
Z1176:Itga8 UTSW 2 12,252,329 (GRCm39) missense probably damaging 1.00
Z1177:Itga8 UTSW 2 12,305,744 (GRCm39) missense possibly damaging 0.89
Predicted Primers
Posted On 2017-06-26