Incidental Mutation 'R6035:Papln'
ID479167
Institutional Source Beutler Lab
Gene Symbol Papln
Ensembl Gene ENSMUSG00000021223
Gene Namepapilin, proteoglycan-like sulfated glycoprotein
SynonymsE030033C16Rik
MMRRC Submission 044207-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6035 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location83763634-83792382 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 83774680 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Alanine at position 262 (G262A)
Ref Sequence ENSEMBL: ENSMUSP00000113806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021646] [ENSMUST00000121733]
Predicted Effect probably damaging
Transcript: ENSMUST00000021646
AA Change: G262A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021646
Gene: ENSMUSG00000021223
AA Change: G262A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TSP1 30 81 3.36e-11 SMART
low complexity region 147 161 N/A INTRINSIC
Pfam:ADAM_spacer1 184 299 3.3e-39 PFAM
TSP1 309 362 1.2e-7 SMART
TSP1 366 426 2.76e-7 SMART
TSP1 427 482 1.42e-9 SMART
TSP1 488 540 2.47e-9 SMART
low complexity region 604 621 N/A INTRINSIC
KU 748 801 1.83e-22 SMART
low complexity region 822 831 N/A INTRINSIC
IGc2 917 980 2.88e-4 SMART
IGc2 1056 1119 2.66e-17 SMART
IGc2 1145 1209 2.13e-7 SMART
Pfam:PLAC 1234 1268 2.3e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121733
AA Change: G262A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113806
Gene: ENSMUSG00000021223
AA Change: G262A

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
TSP1 30 81 3.36e-11 SMART
low complexity region 147 161 N/A INTRINSIC
Pfam:ADAM_spacer1 184 299 2.8e-38 PFAM
TSP1 309 362 1.2e-7 SMART
TSP1 388 448 1.82e-7 SMART
TSP1 449 504 1.42e-9 SMART
TSP1 510 562 2.47e-9 SMART
low complexity region 626 643 N/A INTRINSIC
KU 770 823 1.83e-22 SMART
Pfam:Papilin_u7 831 922 1.9e-40 PFAM
IGc2 939 1002 2.88e-4 SMART
IGc2 1078 1141 2.66e-17 SMART
IGc2 1167 1231 2.13e-7 SMART
Pfam:PLAC 1257 1289 1.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152904
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 98.9%
  • 10x: 91.8%
  • 20x: 70.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m G T 6: 121,638,394 G76W probably damaging Het
Abca17 A T 17: 24,281,245 F1324Y possibly damaging Het
Abca8b A T 11: 109,971,860 probably null Het
Abcc12 A G 8: 86,517,404 M1040T probably damaging Het
Abtb1 A G 6: 88,841,806 F7L probably damaging Het
Adcy9 T C 16: 4,304,513 T558A probably benign Het
Adgrb1 A T 15: 74,540,443 T424S possibly damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ankrd31 C A 13: 96,832,213 P786Q probably benign Het
Arhgap39 G T 15: 76,737,224 Y392* probably null Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Carmil2 G T 8: 105,692,563 W749L probably benign Het
Ccar1 A G 10: 62,751,785 Y867H unknown Het
Cdh13 A G 8: 118,505,698 D47G probably benign Het
Chst9 T A 18: 15,452,853 T218S probably benign Het
Clec2i G A 6: 128,893,624 V67I probably benign Het
Cox7a2 T A 9: 79,759,746 probably benign Het
Cpz A G 5: 35,517,585 C107R probably damaging Het
Dapk1 T A 13: 60,761,199 C1209S possibly damaging Het
Ddx41 T C 13: 55,533,968 M307V probably benign Het
Defa24 A G 8: 21,734,549 I5V probably benign Het
Dgcr8 A T 16: 18,258,314 N2K probably damaging Het
Ebf2 A G 14: 67,238,974 D131G probably damaging Het
Fam149b C T 14: 20,377,917 R424C probably damaging Het
Fbln2 G A 6: 91,263,353 V714M probably damaging Het
Fgf5 T C 5: 98,275,526 Y257H probably damaging Het
Fmo3 A C 1: 162,964,036 V224G probably damaging Het
Gigyf2 T C 1: 87,410,728 I394T possibly damaging Het
Glmn T A 5: 107,593,880 probably null Het
Greb1l T C 18: 10,501,025 I385T possibly damaging Het
Grhl1 C A 12: 24,608,450 Q365K probably benign Het
Gsdme G A 6: 50,229,326 T179M probably damaging Het
Gtf2a1l A G 17: 88,711,534 T349A probably benign Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Il5ra G A 6: 106,741,265 T76I probably damaging Het
Itga8 T C 2: 12,191,714 T631A probably benign Het
Kcnh6 G A 11: 106,019,152 probably null Het
Krt26 C T 11: 99,333,589 E368K probably benign Het
Lhx9 T C 1: 138,838,543 D169G possibly damaging Het
Lman1l A G 9: 57,611,747 probably null Het
Lmod3 A G 6: 97,247,273 L529P probably damaging Het
Mroh2a G A 1: 88,230,668 V146M probably damaging Het
Nup155 A G 15: 8,144,093 T891A probably benign Het
Olfr20 T C 11: 73,353,756 M1T probably null Het
Olfr341 T A 2: 36,479,984 I49F probably damaging Het
Olfr409-ps1 T C 11: 74,317,459 *145R probably null Het
Olfr739 A G 14: 50,424,527 T3A probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Pdcd1lg2 G A 19: 29,446,035 V160I probably benign Het
Pde8b A G 13: 95,027,597 probably benign Het
Ppme1 G A 7: 100,354,795 R68* probably null Het
Ptprn2 A T 12: 117,255,595 N949Y probably damaging Het
Qser1 C A 2: 104,787,123 D1115Y probably damaging Het
Rad54l G T 4: 116,097,469 D674E probably damaging Het
Ripk4 T A 16: 97,744,187 D420V probably damaging Het
Ros1 G T 10: 52,077,971 S1857R probably benign Het
Rsf1 A G 7: 97,662,109 E682G probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Samd4 G A 14: 47,087,872 R515H probably damaging Het
Selp T A 1: 164,141,510 W560R probably benign Het
Shc3 A T 13: 51,461,432 L163Q probably damaging Het
Shh G A 5: 28,461,399 A163V probably damaging Het
Slc17a8 T C 10: 89,592,075 R113G possibly damaging Het
Slc5a6 C A 5: 31,048,824 probably benign Het
Smarcd2 A G 11: 106,266,889 probably null Het
Sytl3 A G 17: 6,728,265 D148G probably damaging Het
Tnks G T 8: 34,918,461 H297Q possibly damaging Het
Trbv21 A T 6: 41,202,634 probably benign Het
Ube3c T C 5: 29,601,163 F268L probably benign Het
Ugt2b5 T C 5: 87,139,682 I209V probably benign Het
Usp1 A G 4: 98,929,845 N140S probably damaging Het
Vcam1 T C 3: 116,125,957 Y226C probably damaging Het
Vmn1r129 T A 7: 21,360,609 Q228L probably damaging Het
Vmn1r209 T A 13: 22,806,032 N163Y probably benign Het
Vmn1r85 A G 7: 13,084,927 S97P probably damaging Het
Vmn2r30 C T 7: 7,334,351 M95I probably benign Het
Vmn2r74 G A 7: 85,951,890 R847C probably damaging Het
Wdr70 G A 15: 7,887,349 T529I possibly damaging Het
Zfp532 T G 18: 65,623,934 S313A possibly damaging Het
Zhx3 A T 2: 160,779,543 N901K probably benign Het
Other mutations in Papln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00824:Papln APN 12 83770436 missense possibly damaging 0.81
IGL01788:Papln APN 12 83775462 missense probably benign 0.32
IGL01889:Papln APN 12 83786835 missense probably benign 0.25
IGL02499:Papln APN 12 83780671 missense probably benign 0.00
IGL02567:Papln APN 12 83778837 missense probably benign 0.00
IGL03150:Papln APN 12 83782984 missense probably damaging 1.00
IGL03331:Papln APN 12 83783661 missense probably benign
F5770:Papln UTSW 12 83778834 missense possibly damaging 0.72
R0201:Papln UTSW 12 83783027 splice site probably benign
R0389:Papln UTSW 12 83783379 nonsense probably null
R0763:Papln UTSW 12 83791865 missense possibly damaging 0.54
R1508:Papln UTSW 12 83782916 missense probably damaging 0.99
R1628:Papln UTSW 12 83784406 splice site probably benign
R1920:Papln UTSW 12 83789254 nonsense probably null
R1974:Papln UTSW 12 83782037 missense probably damaging 0.98
R2004:Papln UTSW 12 83773218 missense probably damaging 1.00
R2105:Papln UTSW 12 83780236 missense probably benign 0.04
R2876:Papln UTSW 12 83778927 missense probably damaging 0.96
R4199:Papln UTSW 12 83783392 missense probably null 0.01
R4702:Papln UTSW 12 83781983 missense probably benign 0.01
R4705:Papln UTSW 12 83777208 splice site probably null
R4835:Papln UTSW 12 83774420 missense probably damaging 0.99
R4874:Papln UTSW 12 83777143 missense probably benign 0.01
R4938:Papln UTSW 12 83782903 missense probably benign 0.35
R5000:Papln UTSW 12 83774889 missense probably damaging 1.00
R5149:Papln UTSW 12 83771882 splice site probably null
R5324:Papln UTSW 12 83774571 missense probably damaging 1.00
R5784:Papln UTSW 12 83781980 missense probably benign
R5881:Papln UTSW 12 83771878 missense probably null 0.91
R5977:Papln UTSW 12 83784369 nonsense probably null
R6035:Papln UTSW 12 83774680 missense probably damaging 1.00
R6291:Papln UTSW 12 83783015 missense probably benign 0.01
R6461:Papln UTSW 12 83781813 splice site probably null
R6536:Papln UTSW 12 83781887 missense probably damaging 1.00
R6861:Papln UTSW 12 83774949 missense probably damaging 1.00
R6898:Papln UTSW 12 83777460 missense probably benign 0.03
R6953:Papln UTSW 12 83781885 nonsense probably null
R7155:Papln UTSW 12 83776521 missense probably damaging 1.00
R7450:Papln UTSW 12 83780171 missense probably benign 0.13
R7510:Papln UTSW 12 83772173 missense probably damaging 0.99
V7580:Papln UTSW 12 83778834 missense possibly damaging 0.72
V7581:Papln UTSW 12 83778834 missense possibly damaging 0.72
V7582:Papln UTSW 12 83778834 missense possibly damaging 0.72
Z1088:Papln UTSW 12 83776376 missense probably benign 0.19
Predicted Primers
Posted On2017-06-26