Mutagenetix > Incidental Mutation

Incidental Mutation 'R6035:Ptprn2'

479168

Institutional Source

Beutler Lab

Gene Symbol

Ptprn2

Ensembl Gene

ENSMUSG00000056553

Gene Name

protein tyrosine phosphatase, receptor type, N polypeptide 2

Synonyms

phogrin, 4930425H11Rik, IA-2 beta, PTP-NP, IA-2beta

MMRRC Submission

044207-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.161) question?

Stock #

R6035 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

116485720-117276849 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 117255595 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 949 (N949Y)

Ref Sequence

ENSEMBL: ENSMUSP00000064046 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]

AlphaFold

P80560

Predicted Effect

probably damaging
Transcript: ENSMUST00000070733
AA Change: N949Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553
AA Change: N949Y

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
RESP18	58	157	1.9e-40	SMART
low complexity region	393	426	N/A	INTRINSIC
Pfam:Receptor_IA-2	495	583	1.5e-35	PFAM
low complexity region	687	707	N/A	INTRINSIC
PTPc	730	993	4.42e-119	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083604

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190132

Predicted Effect

probably benign
Transcript: ENSMUST00000190247

SMART Domains

Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
RESP18	58	157	1.9e-40	SMART
low complexity region	393	426	N/A	INTRINSIC
Pfam:Receptor_IA-2	494	584	2.5e-43	PFAM
transmembrane domain	602	624	N/A	INTRINSIC
low complexity region	687	707	N/A	INTRINSIC
PTPc	730	932	8.81e-64	SMART

Coding Region Coverage

1x: 99.8%
3x: 98.9%
10x: 91.8%
20x: 70.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	G	T	6: 121,638,394	G76W	probably damaging	Het
Abca17	A	T	17: 24,281,245	F1324Y	possibly damaging	Het
Abca8b	A	T	11: 109,971,860		probably null	Het
Abcc12	A	G	8: 86,517,404	M1040T	probably damaging	Het
Abtb1	A	G	6: 88,841,806	F7L	probably damaging	Het
Adcy9	T	C	16: 4,304,513	T558A	probably benign	Het
Adgrb1	A	T	15: 74,540,443	T424S	possibly damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Ankrd31	C	A	13: 96,832,213	P786Q	probably benign	Het
Arhgap39	G	T	15: 76,737,224	Y392*	probably null	Het
Ash1l	T	C	3: 88,985,019	Y1402H	probably damaging	Het
Carmil2	G	T	8: 105,692,563	W749L	probably benign	Het
Ccar1	A	G	10: 62,751,785	Y867H	unknown	Het
Cdh13	A	G	8: 118,505,698	D47G	probably benign	Het
Chst9	T	A	18: 15,452,853	T218S	probably benign	Het
Clec2i	G	A	6: 128,893,624	V67I	probably benign	Het
Cox7a2	T	A	9: 79,759,746		probably benign	Het
Cpz	A	G	5: 35,517,585	C107R	probably damaging	Het
Dapk1	T	A	13: 60,761,199	C1209S	possibly damaging	Het
Ddx41	T	C	13: 55,533,968	M307V	probably benign	Het
Defa24	A	G	8: 21,734,549	I5V	probably benign	Het
Dgcr8	A	T	16: 18,258,314	N2K	probably damaging	Het
Ebf2	A	G	14: 67,238,974	D131G	probably damaging	Het
Fam149b	C	T	14: 20,377,917	R424C	probably damaging	Het
Fbln2	G	A	6: 91,263,353	V714M	probably damaging	Het
Fgf5	T	C	5: 98,275,526	Y257H	probably damaging	Het
Fmo3	A	C	1: 162,964,036	V224G	probably damaging	Het
Gigyf2	T	C	1: 87,410,728	I394T	possibly damaging	Het
Glmn	T	A	5: 107,593,880		probably null	Het
Greb1l	T	C	18: 10,501,025	I385T	possibly damaging	Het
Grhl1	C	A	12: 24,608,450	Q365K	probably benign	Het
Gsdme	G	A	6: 50,229,326	T179M	probably damaging	Het
Gtf2a1l	A	G	17: 88,711,534	T349A	probably benign	Het
Hax1	GTCATCATCATCATCATC	GTCATCATCATCATCATCATC	3: 89,997,940		probably benign	Het
Il5ra	G	A	6: 106,741,265	T76I	probably damaging	Het
Itga8	T	C	2: 12,191,714	T631A	probably benign	Het
Kcnh6	G	A	11: 106,019,152		probably null	Het
Krt26	C	T	11: 99,333,589	E368K	probably benign	Het
Lhx9	T	C	1: 138,838,543	D169G	possibly damaging	Het
Lman1l	A	G	9: 57,611,747		probably null	Het
Lmod3	A	G	6: 97,247,273	L529P	probably damaging	Het
Mroh2a	G	A	1: 88,230,668	V146M	probably damaging	Het
Nup155	A	G	15: 8,144,093	T891A	probably benign	Het
Olfr20	T	C	11: 73,353,756	M1T	probably null	Het
Olfr341	T	A	2: 36,479,984	I49F	probably damaging	Het
Olfr409-ps1	T	C	11: 74,317,459	*145R	probably null	Het
Olfr739	A	G	14: 50,424,527	T3A	probably benign	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Papln	G	C	12: 83,774,680	G262A	probably damaging	Het
Pdcd1lg2	G	A	19: 29,446,035	V160I	probably benign	Het
Pde8b	A	G	13: 95,027,597		probably benign	Het
Ppme1	G	A	7: 100,354,795	R68*	probably null	Het
Qser1	C	A	2: 104,787,123	D1115Y	probably damaging	Het
Rad54l	G	T	4: 116,097,469	D674E	probably damaging	Het
Ripk4	T	A	16: 97,744,187	D420V	probably damaging	Het
Ros1	G	T	10: 52,077,971	S1857R	probably benign	Het
Rsf1	A	G	7: 97,662,109	E682G	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Samd4	G	A	14: 47,087,872	R515H	probably damaging	Het
Selp	T	A	1: 164,141,510	W560R	probably benign	Het
Shc3	A	T	13: 51,461,432	L163Q	probably damaging	Het
Shh	G	A	5: 28,461,399	A163V	probably damaging	Het
Slc17a8	T	C	10: 89,592,075	R113G	possibly damaging	Het
Slc5a6	C	A	5: 31,048,824		probably benign	Het
Smarcd2	A	G	11: 106,266,889		probably null	Het
Sytl3	A	G	17: 6,728,265	D148G	probably damaging	Het
Tnks	G	T	8: 34,918,461	H297Q	possibly damaging	Het
Trbv21	A	T	6: 41,202,634		probably benign	Het
Ube3c	T	C	5: 29,601,163	F268L	probably benign	Het
Ugt2b5	T	C	5: 87,139,682	I209V	probably benign	Het
Usp1	A	G	4: 98,929,845	N140S	probably damaging	Het
Vcam1	T	C	3: 116,125,957	Y226C	probably damaging	Het
Vmn1r129	T	A	7: 21,360,609	Q228L	probably damaging	Het
Vmn1r209	T	A	13: 22,806,032	N163Y	probably benign	Het
Vmn1r85	A	G	7: 13,084,927	S97P	probably damaging	Het
Vmn2r30	C	T	7: 7,334,351	M95I	probably benign	Het
Vmn2r74	G	A	7: 85,951,890	R847C	probably damaging	Het
Wdr70	G	A	15: 7,887,349	T529I	possibly damaging	Het
Zfp532	T	G	18: 65,623,934	S313A	possibly damaging	Het
Zhx3	A	T	2: 160,779,543	N901K	probably benign	Het

Other mutations in Ptprn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01695:Ptprn2	APN	12	116841388	missense	probably benign	0.02
IGL01788:Ptprn2	APN	12	116900987	missense	probably damaging	0.98
IGL02172:Ptprn2	APN	12	116873697	splice site	probably benign
IGL02339:Ptprn2	APN	12	116722104	missense	probably damaging	1.00
IGL02706:Ptprn2	APN	12	116888898	missense	probably damaging	0.96
IGL03018:Ptprn2	APN	12	117211943	missense	probably damaging	1.00
IGL03267:Ptprn2	APN	12	116876344	nonsense	probably null
BB001:Ptprn2	UTSW	12	116841264	missense	probably benign	0.00
BB011:Ptprn2	UTSW	12	116841264	missense	probably benign	0.00
IGL03014:Ptprn2	UTSW	12	117248688	missense	probably damaging	1.00
R0066:Ptprn2	UTSW	12	117276602	missense	probably benign	0.07
R0066:Ptprn2	UTSW	12	117276602	missense	probably benign	0.07
R0115:Ptprn2	UTSW	12	117211846	splice site	probably benign
R0131:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0131:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0132:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0481:Ptprn2	UTSW	12	117211846	splice site	probably benign
R0694:Ptprn2	UTSW	12	116824355	missense	possibly damaging	0.69
R0698:Ptprn2	UTSW	12	116722130	nonsense	probably null
R0746:Ptprn2	UTSW	12	116901017	missense	probably benign	0.00
R1127:Ptprn2	UTSW	12	117212008	splice site	probably null
R1443:Ptprn2	UTSW	12	117253615	missense	probably damaging	1.00
R1508:Ptprn2	UTSW	12	117184722	missense	probably damaging	1.00
R1664:Ptprn2	UTSW	12	117161709	missense	probably damaging	0.99
R1670:Ptprn2	UTSW	12	116722172	missense	possibly damaging	0.64
R1749:Ptprn2	UTSW	12	116580428	missense	probably benign	0.00
R2075:Ptprn2	UTSW	12	117247717	missense	probably benign	0.01
R3054:Ptprn2	UTSW	12	116722133	missense	probably damaging	1.00
R3107:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R3109:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R3552:Ptprn2	UTSW	12	116888877	missense	probably benign	0.00
R4193:Ptprn2	UTSW	12	116901008	missense	probably benign	0.01
R4523:Ptprn2	UTSW	12	116876000	missense	probably damaging	1.00
R4706:Ptprn2	UTSW	12	116872094	missense	probably benign	0.02
R4719:Ptprn2	UTSW	12	116824396	missense	possibly damaging	0.95
R4726:Ptprn2	UTSW	12	117247773	nonsense	probably null
R4872:Ptprn2	UTSW	12	117161694	missense	probably damaging	1.00
R4891:Ptprn2	UTSW	12	117233365	splice site	probably null
R4970:Ptprn2	UTSW	12	117276595	missense	probably damaging	1.00
R5208:Ptprn2	UTSW	12	116858928	missense	probably damaging	1.00
R5287:Ptprn2	UTSW	12	117211862	missense	probably damaging	1.00
R5419:Ptprn2	UTSW	12	117184647	missense	probably damaging	0.99
R6035:Ptprn2	UTSW	12	117255595	missense	probably damaging	1.00
R6180:Ptprn2	UTSW	12	116859119	missense	probably benign	0.05
R6277:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R6465:Ptprn2	UTSW	12	117269589	missense	probably damaging	0.96
R6488:Ptprn2	UTSW	12	116872038	missense	probably benign	0.13
R6555:Ptprn2	UTSW	12	117227200	missense	probably damaging	1.00
R6908:Ptprn2	UTSW	12	116888888	missense	probably benign	0.06
R7120:Ptprn2	UTSW	12	116872056	missense	probably benign	0.01
R7229:Ptprn2	UTSW	12	117227225	splice site	probably null
R7237:Ptprn2	UTSW	12	117161727	missense	probably benign	0.03
R7304:Ptprn2	UTSW	12	117248544	missense	probably damaging	1.00
R7355:Ptprn2	UTSW	12	116858951	missense	probably benign
R7460:Ptprn2	UTSW	12	117248681	missense	probably benign	0.05
R7577:Ptprn2	UTSW	12	116485866	start codon destroyed	probably null
R7658:Ptprn2	UTSW	12	116722119	missense	probably benign	0.01
R7666:Ptprn2	UTSW	12	116841320	missense	probably benign	0.10
R7924:Ptprn2	UTSW	12	116841264	missense	probably benign	0.00
R8219:Ptprn2	UTSW	12	117184737	missense	probably benign	0.30
R8716:Ptprn2	UTSW	12	117255548	missense	possibly damaging	0.73
R9235:Ptprn2	UTSW	12	117269651	critical splice donor site	probably null
R9605:Ptprn2	UTSW	12	117161658	missense	probably benign	0.13
X0066:Ptprn2	UTSW	12	117161760	missense	probably damaging	1.00
X0066:Ptprn2	UTSW	12	117184740	missense	probably benign	0.16

Predicted Primers

Posted On

2017-06-26