Incidental Mutation 'R6035:Ptprn2'
ID479168
Institutional Source Beutler Lab
Gene Symbol Ptprn2
Ensembl Gene ENSMUSG00000056553
Gene Nameprotein tyrosine phosphatase, receptor type, N polypeptide 2
Synonymsphogrin, 4930425H11Rik, IA-2 beta, PTP-NP, IA-2beta
MMRRC Submission 044207-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.294) question?
Stock #R6035 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location116485720-117276849 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 117255595 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 949 (N949Y)
Ref Sequence ENSEMBL: ENSMUSP00000064046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]
Predicted Effect probably damaging
Transcript: ENSMUST00000070733
AA Change: N949Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553
AA Change: N949Y

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 495 583 1.5e-35 PFAM
low complexity region 687 707 N/A INTRINSIC
PTPc 730 993 4.42e-119 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190132
Predicted Effect probably benign
Transcript: ENSMUST00000190247
SMART Domains Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 494 584 2.5e-43 PFAM
transmembrane domain 602 624 N/A INTRINSIC
low complexity region 687 707 N/A INTRINSIC
PTPc 730 932 8.81e-64 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 98.9%
  • 10x: 91.8%
  • 20x: 70.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m G T 6: 121,638,394 G76W probably damaging Het
Abca17 A T 17: 24,281,245 F1324Y possibly damaging Het
Abca8b A T 11: 109,971,860 probably null Het
Abcc12 A G 8: 86,517,404 M1040T probably damaging Het
Abtb1 A G 6: 88,841,806 F7L probably damaging Het
Adcy9 T C 16: 4,304,513 T558A probably benign Het
Adgrb1 A T 15: 74,540,443 T424S possibly damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ankrd31 C A 13: 96,832,213 P786Q probably benign Het
Arhgap39 G T 15: 76,737,224 Y392* probably null Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Carmil2 G T 8: 105,692,563 W749L probably benign Het
Ccar1 A G 10: 62,751,785 Y867H unknown Het
Cdh13 A G 8: 118,505,698 D47G probably benign Het
Chst9 T A 18: 15,452,853 T218S probably benign Het
Clec2i G A 6: 128,893,624 V67I probably benign Het
Cox7a2 T A 9: 79,759,746 probably benign Het
Cpz A G 5: 35,517,585 C107R probably damaging Het
Dapk1 T A 13: 60,761,199 C1209S possibly damaging Het
Ddx41 T C 13: 55,533,968 M307V probably benign Het
Defa24 A G 8: 21,734,549 I5V probably benign Het
Dgcr8 A T 16: 18,258,314 N2K probably damaging Het
Ebf2 A G 14: 67,238,974 D131G probably damaging Het
Fam149b C T 14: 20,377,917 R424C probably damaging Het
Fbln2 G A 6: 91,263,353 V714M probably damaging Het
Fgf5 T C 5: 98,275,526 Y257H probably damaging Het
Fmo3 A C 1: 162,964,036 V224G probably damaging Het
Gigyf2 T C 1: 87,410,728 I394T possibly damaging Het
Glmn T A 5: 107,593,880 probably null Het
Greb1l T C 18: 10,501,025 I385T possibly damaging Het
Grhl1 C A 12: 24,608,450 Q365K probably benign Het
Gsdme G A 6: 50,229,326 T179M probably damaging Het
Gtf2a1l A G 17: 88,711,534 T349A probably benign Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Il5ra G A 6: 106,741,265 T76I probably damaging Het
Itga8 T C 2: 12,191,714 T631A probably benign Het
Kcnh6 G A 11: 106,019,152 probably null Het
Krt26 C T 11: 99,333,589 E368K probably benign Het
Lhx9 T C 1: 138,838,543 D169G possibly damaging Het
Lman1l A G 9: 57,611,747 probably null Het
Lmod3 A G 6: 97,247,273 L529P probably damaging Het
Mroh2a G A 1: 88,230,668 V146M probably damaging Het
Nup155 A G 15: 8,144,093 T891A probably benign Het
Olfr20 T C 11: 73,353,756 M1T probably null Het
Olfr341 T A 2: 36,479,984 I49F probably damaging Het
Olfr409-ps1 T C 11: 74,317,459 *145R probably null Het
Olfr739 A G 14: 50,424,527 T3A probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Papln G C 12: 83,774,680 G262A probably damaging Het
Pdcd1lg2 G A 19: 29,446,035 V160I probably benign Het
Pde8b A G 13: 95,027,597 probably benign Het
Ppme1 G A 7: 100,354,795 R68* probably null Het
Qser1 C A 2: 104,787,123 D1115Y probably damaging Het
Rad54l G T 4: 116,097,469 D674E probably damaging Het
Ripk4 T A 16: 97,744,187 D420V probably damaging Het
Ros1 G T 10: 52,077,971 S1857R probably benign Het
Rsf1 A G 7: 97,662,109 E682G probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Samd4 G A 14: 47,087,872 R515H probably damaging Het
Selp T A 1: 164,141,510 W560R probably benign Het
Shc3 A T 13: 51,461,432 L163Q probably damaging Het
Shh G A 5: 28,461,399 A163V probably damaging Het
Slc17a8 T C 10: 89,592,075 R113G possibly damaging Het
Slc5a6 C A 5: 31,048,824 probably benign Het
Smarcd2 A G 11: 106,266,889 probably null Het
Sytl3 A G 17: 6,728,265 D148G probably damaging Het
Tnks G T 8: 34,918,461 H297Q possibly damaging Het
Trbv21 A T 6: 41,202,634 probably benign Het
Ube3c T C 5: 29,601,163 F268L probably benign Het
Ugt2b5 T C 5: 87,139,682 I209V probably benign Het
Usp1 A G 4: 98,929,845 N140S probably damaging Het
Vcam1 T C 3: 116,125,957 Y226C probably damaging Het
Vmn1r129 T A 7: 21,360,609 Q228L probably damaging Het
Vmn1r209 T A 13: 22,806,032 N163Y probably benign Het
Vmn1r85 A G 7: 13,084,927 S97P probably damaging Het
Vmn2r30 C T 7: 7,334,351 M95I probably benign Het
Vmn2r74 G A 7: 85,951,890 R847C probably damaging Het
Wdr70 G A 15: 7,887,349 T529I possibly damaging Het
Zfp532 T G 18: 65,623,934 S313A possibly damaging Het
Zhx3 A T 2: 160,779,543 N901K probably benign Het
Other mutations in Ptprn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01695:Ptprn2 APN 12 116841388 missense probably benign 0.02
IGL01788:Ptprn2 APN 12 116900987 missense probably damaging 0.98
IGL02172:Ptprn2 APN 12 116873697 splice site probably benign
IGL02339:Ptprn2 APN 12 116722104 missense probably damaging 1.00
IGL02706:Ptprn2 APN 12 116888898 missense probably damaging 0.96
IGL03018:Ptprn2 APN 12 117211943 missense probably damaging 1.00
IGL03267:Ptprn2 APN 12 116876344 nonsense probably null
BB001:Ptprn2 UTSW 12 116841264 missense probably benign 0.00
BB011:Ptprn2 UTSW 12 116841264 missense probably benign 0.00
IGL03014:Ptprn2 UTSW 12 117248688 missense probably damaging 1.00
R0066:Ptprn2 UTSW 12 117276602 missense probably benign 0.07
R0066:Ptprn2 UTSW 12 117276602 missense probably benign 0.07
R0115:Ptprn2 UTSW 12 117211846 splice site probably benign
R0131:Ptprn2 UTSW 12 116722091 missense probably damaging 1.00
R0131:Ptprn2 UTSW 12 116722091 missense probably damaging 1.00
R0132:Ptprn2 UTSW 12 116722091 missense probably damaging 1.00
R0481:Ptprn2 UTSW 12 117211846 splice site probably benign
R0694:Ptprn2 UTSW 12 116824355 missense possibly damaging 0.69
R0698:Ptprn2 UTSW 12 116722130 nonsense probably null
R0746:Ptprn2 UTSW 12 116901017 missense probably benign 0.00
R1127:Ptprn2 UTSW 12 117212008 splice site probably null
R1443:Ptprn2 UTSW 12 117253615 missense probably damaging 1.00
R1508:Ptprn2 UTSW 12 117184722 missense probably damaging 1.00
R1664:Ptprn2 UTSW 12 117161709 missense probably damaging 0.99
R1670:Ptprn2 UTSW 12 116722172 missense possibly damaging 0.64
R1749:Ptprn2 UTSW 12 116580428 missense probably benign 0.00
R2075:Ptprn2 UTSW 12 117247717 missense probably benign 0.01
R3054:Ptprn2 UTSW 12 116722133 missense probably damaging 1.00
R3107:Ptprn2 UTSW 12 116876180 missense probably benign 0.04
R3109:Ptprn2 UTSW 12 116876180 missense probably benign 0.04
R3552:Ptprn2 UTSW 12 116888877 missense probably benign 0.00
R4193:Ptprn2 UTSW 12 116901008 missense probably benign 0.01
R4523:Ptprn2 UTSW 12 116876000 missense probably damaging 1.00
R4706:Ptprn2 UTSW 12 116872094 missense probably benign 0.02
R4719:Ptprn2 UTSW 12 116824396 missense possibly damaging 0.95
R4726:Ptprn2 UTSW 12 117247773 nonsense probably null
R4872:Ptprn2 UTSW 12 117161694 missense probably damaging 1.00
R4891:Ptprn2 UTSW 12 117233365 splice site probably null
R4970:Ptprn2 UTSW 12 117276595 missense probably damaging 1.00
R5208:Ptprn2 UTSW 12 116858928 missense probably damaging 1.00
R5287:Ptprn2 UTSW 12 117211862 missense probably damaging 1.00
R5419:Ptprn2 UTSW 12 117184647 missense probably damaging 0.99
R6035:Ptprn2 UTSW 12 117255595 missense probably damaging 1.00
R6180:Ptprn2 UTSW 12 116859119 missense probably benign 0.05
R6277:Ptprn2 UTSW 12 116876180 missense probably benign 0.04
R6465:Ptprn2 UTSW 12 117269589 missense probably damaging 0.96
R6488:Ptprn2 UTSW 12 116872038 missense probably benign 0.13
R6555:Ptprn2 UTSW 12 117227200 missense probably damaging 1.00
R6908:Ptprn2 UTSW 12 116888888 missense probably benign 0.06
R7120:Ptprn2 UTSW 12 116872056 missense probably benign 0.01
R7229:Ptprn2 UTSW 12 117227225 splice site probably null
R7237:Ptprn2 UTSW 12 117161727 missense probably benign 0.03
R7304:Ptprn2 UTSW 12 117248544 missense probably damaging 1.00
R7355:Ptprn2 UTSW 12 116858951 missense probably benign
R7460:Ptprn2 UTSW 12 117248681 missense probably benign 0.05
R7577:Ptprn2 UTSW 12 116485866 start codon destroyed probably null
R7658:Ptprn2 UTSW 12 116722119 missense probably benign 0.01
R7666:Ptprn2 UTSW 12 116841320 missense probably benign 0.10
R7924:Ptprn2 UTSW 12 116841264 missense probably benign 0.00
R8219:Ptprn2 UTSW 12 117184737 missense probably benign 0.30
R8716:Ptprn2 UTSW 12 117255548 missense possibly damaging 0.73
X0066:Ptprn2 UTSW 12 117161760 missense probably damaging 1.00
X0066:Ptprn2 UTSW 12 117184740 missense probably benign 0.16
Predicted Primers
Posted On2017-06-26