Incidental Mutation 'R6035:Dgcr8'
ID479183
Institutional Source Beutler Lab
Gene Symbol Dgcr8
Ensembl Gene ENSMUSG00000022718
Gene NameDGCR8, microprocessor complex subunit
SynonymsGy1, D16H22S788E, D16Wis2, D16H22S1742E, Vo59c07, N41
MMRRC Submission 044207-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6035 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location18253948-18289246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18258314 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 2 (N2K)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009321] [ENSMUST00000100099] [ENSMUST00000115633] [ENSMUST00000115640] [ENSMUST00000128045] [ENSMUST00000140206]
Predicted Effect probably damaging
Transcript: ENSMUST00000009321
AA Change: N668K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000009321
Gene: ENSMUSG00000022718
AA Change: N668K

DomainStartEndE-ValueType
low complexity region 165 176 N/A INTRINSIC
WW 302 334 7.26e-6 SMART
low complexity region 411 421 N/A INTRINSIC
DSRM 512 577 5.68e-10 SMART
DSRM 620 685 8.26e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000059696
Predicted Effect probably benign
Transcript: ENSMUST00000100099
SMART Domains Protein: ENSMUSP00000111303
Gene: ENSMUSG00000022721

DomainStartEndE-ValueType
low complexity region 35 44 N/A INTRINSIC
RRM 64 132 1.37e-2 SMART
coiled coil region 171 195 N/A INTRINSIC
Pfam:tRNA_U5-meth_tr 380 579 1.2e-20 PFAM
Pfam:PCMT 386 482 1.1e-8 PFAM
Pfam:MTS 389 489 6.2e-9 PFAM
Pfam:Methyltransf_4 397 497 4.2e-7 PFAM
Pfam:Methyltransf_31 420 546 6.2e-15 PFAM
Pfam:Methyltransf_18 422 523 9.3e-11 PFAM
Pfam:Methyltransf_26 423 538 5.3e-12 PFAM
Pfam:Methyltransf_25 426 511 3.5e-8 PFAM
Pfam:Methyltransf_11 427 487 5.6e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115633
SMART Domains Protein: ENSMUSP00000111296
Gene: ENSMUSG00000022718

DomainStartEndE-ValueType
low complexity region 165 176 N/A INTRINSIC
WW 302 334 7.26e-6 SMART
low complexity region 411 421 N/A INTRINSIC
DSRM 512 577 5.68e-10 SMART
DSRM 620 685 8.26e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115640
SMART Domains Protein: ENSMUSP00000111304
Gene: ENSMUSG00000022721

DomainStartEndE-ValueType
low complexity region 35 44 N/A INTRINSIC
RRM 64 132 1.37e-2 SMART
coiled coil region 171 195 N/A INTRINSIC
Pfam:tRNA_U5-meth_tr 380 579 2.6e-20 PFAM
Pfam:PCMT 386 482 3.4e-9 PFAM
Pfam:MTS 392 489 1e-7 PFAM
Pfam:Cons_hypoth95 405 542 2.7e-7 PFAM
Pfam:Methyltransf_31 420 547 2.1e-15 PFAM
Pfam:Methyltransf_18 422 526 2.9e-12 PFAM
Pfam:Methyltransf_4 423 499 2.6e-7 PFAM
Pfam:Methyltransf_25 426 511 1.3e-8 PFAM
Pfam:Methyltransf_11 427 489 3.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127239
Predicted Effect probably benign
Transcript: ENSMUST00000128045
Predicted Effect probably benign
Transcript: ENSMUST00000140206
SMART Domains Protein: ENSMUSP00000121216
Gene: ENSMUSG00000022721

DomainStartEndE-ValueType
low complexity region 35 44 N/A INTRINSIC
RRM 64 132 1.37e-2 SMART
coiled coil region 171 195 N/A INTRINSIC
Pfam:tRNA_U5-meth_tr 383 481 3.7e-8 PFAM
Pfam:PCMT 386 481 1.5e-6 PFAM
Pfam:MTS 389 493 2.5e-7 PFAM
Pfam:Methyltransf_31 420 491 1.5e-9 PFAM
Pfam:Methyltransf_18 422 508 4.1e-8 PFAM
Pfam:Methyltransf_26 423 523 3.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153292
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232015
Predicted Effect probably damaging
Transcript: ENSMUST00000232144
AA Change: N2K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000232293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232476
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 98.9%
  • 10x: 91.8%
  • 20x: 70.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the microprocessor complex which mediates the biogenesis of microRNAs from the primary microRNA transcript. The encoded protein is a double-stranded RNA binding protein that functions as the non-catalytic subunit of the microprocessor complex. This protein is required for binding the double-stranded RNA substrate and facilitates cleavage of the RNA by the ribonuclease III protein, Drosha. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice heterozygous for a gene trap allele exhibit reduced dendritic spine number and dendritiic complexity along with abnormal prepulse inhibition and abnormal spatial working memory. Homozygous mice are embryonic lethal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m G T 6: 121,638,394 G76W probably damaging Het
Abca17 A T 17: 24,281,245 F1324Y possibly damaging Het
Abca8b A T 11: 109,971,860 probably null Het
Abcc12 A G 8: 86,517,404 M1040T probably damaging Het
Abtb1 A G 6: 88,841,806 F7L probably damaging Het
Adcy9 T C 16: 4,304,513 T558A probably benign Het
Adgrb1 A T 15: 74,540,443 T424S possibly damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ankrd31 C A 13: 96,832,213 P786Q probably benign Het
Arhgap39 G T 15: 76,737,224 Y392* probably null Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Carmil2 G T 8: 105,692,563 W749L probably benign Het
Ccar1 A G 10: 62,751,785 Y867H unknown Het
Cdh13 A G 8: 118,505,698 D47G probably benign Het
Chst9 T A 18: 15,452,853 T218S probably benign Het
Clec2i G A 6: 128,893,624 V67I probably benign Het
Cox7a2 T A 9: 79,759,746 probably benign Het
Cpz A G 5: 35,517,585 C107R probably damaging Het
Dapk1 T A 13: 60,761,199 C1209S possibly damaging Het
Ddx41 T C 13: 55,533,968 M307V probably benign Het
Defa24 A G 8: 21,734,549 I5V probably benign Het
Ebf2 A G 14: 67,238,974 D131G probably damaging Het
Fam149b C T 14: 20,377,917 R424C probably damaging Het
Fbln2 G A 6: 91,263,353 V714M probably damaging Het
Fgf5 T C 5: 98,275,526 Y257H probably damaging Het
Fmo3 A C 1: 162,964,036 V224G probably damaging Het
Gigyf2 T C 1: 87,410,728 I394T possibly damaging Het
Glmn T A 5: 107,593,880 probably null Het
Greb1l T C 18: 10,501,025 I385T possibly damaging Het
Grhl1 C A 12: 24,608,450 Q365K probably benign Het
Gsdme G A 6: 50,229,326 T179M probably damaging Het
Gtf2a1l A G 17: 88,711,534 T349A probably benign Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Il5ra G A 6: 106,741,265 T76I probably damaging Het
Itga8 T C 2: 12,191,714 T631A probably benign Het
Kcnh6 G A 11: 106,019,152 probably null Het
Krt26 C T 11: 99,333,589 E368K probably benign Het
Lhx9 T C 1: 138,838,543 D169G possibly damaging Het
Lman1l A G 9: 57,611,747 probably null Het
Lmod3 A G 6: 97,247,273 L529P probably damaging Het
Mroh2a G A 1: 88,230,668 V146M probably damaging Het
Nup155 A G 15: 8,144,093 T891A probably benign Het
Olfr20 T C 11: 73,353,756 M1T probably null Het
Olfr341 T A 2: 36,479,984 I49F probably damaging Het
Olfr409-ps1 T C 11: 74,317,459 *145R probably null Het
Olfr739 A G 14: 50,424,527 T3A probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Papln G C 12: 83,774,680 G262A probably damaging Het
Pdcd1lg2 G A 19: 29,446,035 V160I probably benign Het
Pde8b A G 13: 95,027,597 probably benign Het
Ppme1 G A 7: 100,354,795 R68* probably null Het
Ptprn2 A T 12: 117,255,595 N949Y probably damaging Het
Qser1 C A 2: 104,787,123 D1115Y probably damaging Het
Rad54l G T 4: 116,097,469 D674E probably damaging Het
Ripk4 T A 16: 97,744,187 D420V probably damaging Het
Ros1 G T 10: 52,077,971 S1857R probably benign Het
Rsf1 A G 7: 97,662,109 E682G probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Samd4 G A 14: 47,087,872 R515H probably damaging Het
Selp T A 1: 164,141,510 W560R probably benign Het
Shc3 A T 13: 51,461,432 L163Q probably damaging Het
Shh G A 5: 28,461,399 A163V probably damaging Het
Slc17a8 T C 10: 89,592,075 R113G possibly damaging Het
Slc5a6 C A 5: 31,048,824 probably benign Het
Smarcd2 A G 11: 106,266,889 probably null Het
Sytl3 A G 17: 6,728,265 D148G probably damaging Het
Tnks G T 8: 34,918,461 H297Q possibly damaging Het
Trbv21 A T 6: 41,202,634 probably benign Het
Ube3c T C 5: 29,601,163 F268L probably benign Het
Ugt2b5 T C 5: 87,139,682 I209V probably benign Het
Usp1 A G 4: 98,929,845 N140S probably damaging Het
Vcam1 T C 3: 116,125,957 Y226C probably damaging Het
Vmn1r129 T A 7: 21,360,609 Q228L probably damaging Het
Vmn1r209 T A 13: 22,806,032 N163Y probably benign Het
Vmn1r85 A G 7: 13,084,927 S97P probably damaging Het
Vmn2r30 C T 7: 7,334,351 M95I probably benign Het
Vmn2r74 G A 7: 85,951,890 R847C probably damaging Het
Wdr70 G A 15: 7,887,349 T529I possibly damaging Het
Zfp532 T G 18: 65,623,934 S313A possibly damaging Het
Zhx3 A T 2: 160,779,543 N901K probably benign Het
Other mutations in Dgcr8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01525:Dgcr8 APN 16 18283944 missense probably damaging 1.00
IGL01767:Dgcr8 APN 16 18278336 missense probably damaging 0.98
IGL02349:Dgcr8 APN 16 18280306 missense possibly damaging 0.67
IGL02834:Dgcr8 APN 16 18272759 missense probably benign 0.08
disneyland UTSW 16 18259623 missense probably damaging 1.00
R1558:Dgcr8 UTSW 16 18259588 missense probably damaging 1.00
R1587:Dgcr8 UTSW 16 18280291 missense probably damaging 1.00
R1656:Dgcr8 UTSW 16 18256713 missense probably benign 0.00
R1866:Dgcr8 UTSW 16 18258314 missense probably damaging 1.00
R1886:Dgcr8 UTSW 16 18278354 missense possibly damaging 0.95
R2144:Dgcr8 UTSW 16 18284256 missense probably damaging 1.00
R2145:Dgcr8 UTSW 16 18280230 missense probably benign 0.26
R3773:Dgcr8 UTSW 16 18256775 missense probably damaging 0.99
R4568:Dgcr8 UTSW 16 18280394 missense probably benign 0.14
R4783:Dgcr8 UTSW 16 18258310 nonsense probably null
R4784:Dgcr8 UTSW 16 18258310 nonsense probably null
R5138:Dgcr8 UTSW 16 18278077 missense probably damaging 0.99
R5276:Dgcr8 UTSW 16 18283771 missense probably benign 0.01
R5476:Dgcr8 UTSW 16 18259979 missense probably damaging 1.00
R5510:Dgcr8 UTSW 16 18277175 missense probably damaging 0.98
R5745:Dgcr8 UTSW 16 18280443 missense probably benign 0.01
R5771:Dgcr8 UTSW 16 18272768 missense probably benign 0.25
R6035:Dgcr8 UTSW 16 18258314 missense probably damaging 1.00
R6182:Dgcr8 UTSW 16 18280308 missense probably benign 0.00
R6190:Dgcr8 UTSW 16 18284410 missense probably damaging 0.97
R6633:Dgcr8 UTSW 16 18284182 missense possibly damaging 0.94
R6786:Dgcr8 UTSW 16 18283829 nonsense probably null
R7468:Dgcr8 UTSW 16 18259623 missense probably damaging 1.00
Z1176:Dgcr8 UTSW 16 18278318 critical splice donor site probably null
Predicted Primers
Posted On2017-06-26