Mutagenetix > Incidental Mutation

Incidental Mutation 'R6035:Greb1l'

479188

Institutional Source

Beutler Lab

Gene Symbol

Greb1l

Ensembl Gene

ENSMUSG00000042942

Gene Name

growth regulation by estrogen in breast cancer-like

Synonyms

AK220484, mKIAA4095

MMRRC Submission

044207-MU

Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6035 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

10325177-10562934 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 10501025 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 385 (I385T)

Ref Sequence

ENSEMBL: ENSMUSP00000134090 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532]

AlphaFold

B9EJV3

Predicted Effect

probably benign
Transcript: ENSMUST00000048977
AA Change: I385T

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: I385T

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	1172	N/A	PFAM
Pfam:GREB1	1154	1913	N/A	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000172532
AA Change: I385T

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942
AA Change: I385T

Domain	Start	End	E-Value	Type
low complexity region	83	100	N/A	INTRINSIC
low complexity region	282	301	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173356

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224958

Coding Region Coverage

1x: 99.8%
3x: 98.9%
10x: 91.8%
20x: 70.9%

Validation Efficiency

Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	G	T	6: 121,638,394	G76W	probably damaging	Het
Abca17	A	T	17: 24,281,245	F1324Y	possibly damaging	Het
Abca8b	A	T	11: 109,971,860		probably null	Het
Abcc12	A	G	8: 86,517,404	M1040T	probably damaging	Het
Abtb1	A	G	6: 88,841,806	F7L	probably damaging	Het
Adcy9	T	C	16: 4,304,513	T558A	probably benign	Het
Adgrb1	A	T	15: 74,540,443	T424S	possibly damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Ankrd31	C	A	13: 96,832,213	P786Q	probably benign	Het
Arhgap39	G	T	15: 76,737,224	Y392*	probably null	Het
Ash1l	T	C	3: 88,985,019	Y1402H	probably damaging	Het
Carmil2	G	T	8: 105,692,563	W749L	probably benign	Het
Ccar1	A	G	10: 62,751,785	Y867H	unknown	Het
Cdh13	A	G	8: 118,505,698	D47G	probably benign	Het
Chst9	T	A	18: 15,452,853	T218S	probably benign	Het
Clec2i	G	A	6: 128,893,624	V67I	probably benign	Het
Cox7a2	T	A	9: 79,759,746		probably benign	Het
Cpz	A	G	5: 35,517,585	C107R	probably damaging	Het
Dapk1	T	A	13: 60,761,199	C1209S	possibly damaging	Het
Ddx41	T	C	13: 55,533,968	M307V	probably benign	Het
Defa24	A	G	8: 21,734,549	I5V	probably benign	Het
Dgcr8	A	T	16: 18,258,314	N2K	probably damaging	Het
Ebf2	A	G	14: 67,238,974	D131G	probably damaging	Het
Fam149b	C	T	14: 20,377,917	R424C	probably damaging	Het
Fbln2	G	A	6: 91,263,353	V714M	probably damaging	Het
Fgf5	T	C	5: 98,275,526	Y257H	probably damaging	Het
Fmo3	A	C	1: 162,964,036	V224G	probably damaging	Het
Gigyf2	T	C	1: 87,410,728	I394T	possibly damaging	Het
Glmn	T	A	5: 107,593,880		probably null	Het
Grhl1	C	A	12: 24,608,450	Q365K	probably benign	Het
Gsdme	G	A	6: 50,229,326	T179M	probably damaging	Het
Gtf2a1l	A	G	17: 88,711,534	T349A	probably benign	Het
Hax1	GTCATCATCATCATCATC	GTCATCATCATCATCATCATC	3: 89,997,940		probably benign	Het
Il5ra	G	A	6: 106,741,265	T76I	probably damaging	Het
Itga8	T	C	2: 12,191,714	T631A	probably benign	Het
Kcnh6	G	A	11: 106,019,152		probably null	Het
Krt26	C	T	11: 99,333,589	E368K	probably benign	Het
Lhx9	T	C	1: 138,838,543	D169G	possibly damaging	Het
Lman1l	A	G	9: 57,611,747		probably null	Het
Lmod3	A	G	6: 97,247,273	L529P	probably damaging	Het
Mroh2a	G	A	1: 88,230,668	V146M	probably damaging	Het
Nup155	A	G	15: 8,144,093	T891A	probably benign	Het
Olfr20	T	C	11: 73,353,756	M1T	probably null	Het
Olfr341	T	A	2: 36,479,984	I49F	probably damaging	Het
Olfr409-ps1	T	C	11: 74,317,459	*145R	probably null	Het
Olfr739	A	G	14: 50,424,527	T3A	probably benign	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Papln	G	C	12: 83,774,680	G262A	probably damaging	Het
Pdcd1lg2	G	A	19: 29,446,035	V160I	probably benign	Het
Pde8b	A	G	13: 95,027,597		probably benign	Het
Ppme1	G	A	7: 100,354,795	R68*	probably null	Het
Ptprn2	A	T	12: 117,255,595	N949Y	probably damaging	Het
Qser1	C	A	2: 104,787,123	D1115Y	probably damaging	Het
Rad54l	G	T	4: 116,097,469	D674E	probably damaging	Het
Ripk4	T	A	16: 97,744,187	D420V	probably damaging	Het
Ros1	G	T	10: 52,077,971	S1857R	probably benign	Het
Rsf1	A	G	7: 97,662,109	E682G	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Samd4	G	A	14: 47,087,872	R515H	probably damaging	Het
Selp	T	A	1: 164,141,510	W560R	probably benign	Het
Shc3	A	T	13: 51,461,432	L163Q	probably damaging	Het
Shh	G	A	5: 28,461,399	A163V	probably damaging	Het
Slc17a8	T	C	10: 89,592,075	R113G	possibly damaging	Het
Slc5a6	C	A	5: 31,048,824		probably benign	Het
Smarcd2	A	G	11: 106,266,889		probably null	Het
Sytl3	A	G	17: 6,728,265	D148G	probably damaging	Het
Tnks	G	T	8: 34,918,461	H297Q	possibly damaging	Het
Trbv21	A	T	6: 41,202,634		probably benign	Het
Ube3c	T	C	5: 29,601,163	F268L	probably benign	Het
Ugt2b5	T	C	5: 87,139,682	I209V	probably benign	Het
Usp1	A	G	4: 98,929,845	N140S	probably damaging	Het
Vcam1	T	C	3: 116,125,957	Y226C	probably damaging	Het
Vmn1r129	T	A	7: 21,360,609	Q228L	probably damaging	Het
Vmn1r209	T	A	13: 22,806,032	N163Y	probably benign	Het
Vmn1r85	A	G	7: 13,084,927	S97P	probably damaging	Het
Vmn2r30	C	T	7: 7,334,351	M95I	probably benign	Het
Vmn2r74	G	A	7: 85,951,890	R847C	probably damaging	Het
Wdr70	G	A	15: 7,887,349	T529I	possibly damaging	Het
Zfp532	T	G	18: 65,623,934	S313A	possibly damaging	Het
Zhx3	A	T	2: 160,779,543	N901K	probably benign	Het

Other mutations in Greb1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Greb1l	APN	18	10555962	missense	possibly damaging	0.90
IGL01554:Greb1l	APN	18	10522144	missense	probably benign	0.01
IGL01563:Greb1l	APN	18	10469399	missense	probably damaging	0.99
IGL01944:Greb1l	APN	18	10557280	missense	possibly damaging	0.91
IGL02110:Greb1l	APN	18	10515271	missense	probably damaging	1.00
IGL02249:Greb1l	APN	18	10532961	missense	probably damaging	1.00
IGL02318:Greb1l	APN	18	10469388	missense	possibly damaging	0.91
IGL02340:Greb1l	APN	18	10515200	missense	probably damaging	0.99
IGL02516:Greb1l	APN	18	10537064	missense	probably benign	0.31
IGL02566:Greb1l	APN	18	10503299	missense	probably damaging	0.99
IGL02583:Greb1l	APN	18	10542362	missense	probably damaging	1.00
IGL02838:Greb1l	APN	18	10560430	missense	probably damaging	1.00
A4554:Greb1l	UTSW	18	10532862	missense	possibly damaging	0.58
PIT4453001:Greb1l	UTSW	18	10533031	missense	probably damaging	0.98
PIT4453001:Greb1l	UTSW	18	10533032	missense	probably benign	0.08
R0099:Greb1l	UTSW	18	10509158	missense	probably damaging	1.00
R0226:Greb1l	UTSW	18	10522076	intron	probably benign
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0239:Greb1l	UTSW	18	10458567	splice site	probably benign
R0316:Greb1l	UTSW	18	10547420	missense	probably damaging	1.00
R0369:Greb1l	UTSW	18	10469375	missense	possibly damaging	0.80
R0394:Greb1l	UTSW	18	10523374	missense	probably damaging	0.99
R0478:Greb1l	UTSW	18	10509281	missense	probably damaging	1.00
R0555:Greb1l	UTSW	18	10458781	splice site	probably benign
R0671:Greb1l	UTSW	18	10474303	missense	probably damaging	1.00
R1282:Greb1l	UTSW	18	10547289	missense	probably benign	0.13
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1607:Greb1l	UTSW	18	10529703	missense	possibly damaging	0.85
R1666:Greb1l	UTSW	18	10501080	critical splice donor site	probably null
R1666:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R1720:Greb1l	UTSW	18	10553848	missense	probably benign	0.19
R1808:Greb1l	UTSW	18	10542143	missense	probably benign
R1829:Greb1l	UTSW	18	10509314	missense	probably damaging	1.00
R1897:Greb1l	UTSW	18	10498992	missense	probably benign	0.00
R1967:Greb1l	UTSW	18	10501049	missense	possibly damaging	0.91
R2025:Greb1l	UTSW	18	10515221	missense	possibly damaging	0.71
R2086:Greb1l	UTSW	18	10523281	missense	probably damaging	1.00
R2125:Greb1l	UTSW	18	10511422	missense	probably damaging	0.98
R2139:Greb1l	UTSW	18	10555011	missense	probably damaging	1.00
R2255:Greb1l	UTSW	18	10554857	missense	probably damaging	1.00
R2256:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2257:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2880:Greb1l	UTSW	18	10547288	missense	possibly damaging	0.93
R3623:Greb1l	UTSW	18	10542380	missense	probably damaging	0.99
R3778:Greb1l	UTSW	18	10469444	missense	possibly damaging	0.60
R3975:Greb1l	UTSW	18	10522247	missense	possibly damaging	0.71
R4038:Greb1l	UTSW	18	10515209	missense	possibly damaging	0.93
R4062:Greb1l	UTSW	18	10522150	missense	probably damaging	0.99
R4134:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R4342:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R4409:Greb1l	UTSW	18	10503182	missense	possibly damaging	0.70
R4600:Greb1l	UTSW	18	10553705	missense	probably damaging	1.00
R4618:Greb1l	UTSW	18	10498965	missense	probably benign	0.00
R4683:Greb1l	UTSW	18	10529563	splice site	probably null
R4686:Greb1l	UTSW	18	10522112	missense	probably damaging	0.98
R4707:Greb1l	UTSW	18	10532922	missense	probably benign	0.02
R4780:Greb1l	UTSW	18	10541792	missense	probably benign	0.00
R4819:Greb1l	UTSW	18	10458358	missense	probably damaging	1.00
R4925:Greb1l	UTSW	18	10547447	missense	possibly damaging	0.79
R4960:Greb1l	UTSW	18	10547306	missense	probably damaging	0.99
R5150:Greb1l	UTSW	18	10555950	frame shift	probably null
R5154:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5269:Greb1l	UTSW	18	10511409	missense	probably benign
R5290:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5310:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5328:Greb1l	UTSW	18	10553720	missense	probably damaging	1.00
R5337:Greb1l	UTSW	18	10509143	missense	probably damaging	1.00
R5393:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5402:Greb1l	UTSW	18	10537169	missense	probably benign	0.26
R5718:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5719:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5720:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5721:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5902:Greb1l	UTSW	18	10538302	missense	probably benign	0.00
R5993:Greb1l	UTSW	18	10544455	missense	probably benign	0.10
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6045:Greb1l	UTSW	18	10547068	missense	probably damaging	1.00
R6063:Greb1l	UTSW	18	10557340	missense	probably damaging	1.00
R6297:Greb1l	UTSW	18	10469494	missense	probably damaging	1.00
R6405:Greb1l	UTSW	18	10501076	missense	probably benign	0.30
R6552:Greb1l	UTSW	18	10541814	missense	probably benign	0.00
R6572:Greb1l	UTSW	18	10522131	missense	probably benign	0.07
R6575:Greb1l	UTSW	18	10547347	missense	possibly damaging	0.88
R6922:Greb1l	UTSW	18	10547482	missense	possibly damaging	0.88
R6957:Greb1l	UTSW	18	10558786	missense	probably benign	0.23
R6962:Greb1l	UTSW	18	10547327	missense	probably damaging	1.00
R7012:Greb1l	UTSW	18	10529707	critical splice donor site	probably null
R7179:Greb1l	UTSW	18	10544576	missense	probably benign	0.00
R7251:Greb1l	UTSW	18	10515319	missense	probably damaging	1.00
R7275:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R7301:Greb1l	UTSW	18	10544970	missense	probably damaging	1.00
R7307:Greb1l	UTSW	18	10538142	missense	probably damaging	0.99
R7455:Greb1l	UTSW	18	10554915	missense	probably damaging	1.00
R7832:Greb1l	UTSW	18	10542056	missense	probably benign	0.38
R7934:Greb1l	UTSW	18	10474371	nonsense	probably null
R8137:Greb1l	UTSW	18	10474357	missense	possibly damaging	0.77
R8138:Greb1l	UTSW	18	10533060	missense	probably benign	0.13
R8208:Greb1l	UTSW	18	10510703	missense	probably damaging	1.00
R8227:Greb1l	UTSW	18	10515371	missense	probably damaging	1.00
R8312:Greb1l	UTSW	18	10511587	intron	probably benign
R8331:Greb1l	UTSW	18	10458706	missense	possibly damaging	0.96
R8364:Greb1l	UTSW	18	10529687	missense	possibly damaging	0.85
R8389:Greb1l	UTSW	18	10529613	missense	probably benign	0.00
R8695:Greb1l	UTSW	18	10544450	missense	probably benign	0.01
R8795:Greb1l	UTSW	18	10553739	missense	probably damaging	0.98
R8836:Greb1l	UTSW	18	10509257	missense	probably benign	0.30
R8862:Greb1l	UTSW	18	10555042	missense	possibly damaging	0.90
R8872:Greb1l	UTSW	18	10529684	missense	probably benign	0.18
R8874:Greb1l	UTSW	18	10544896	missense	probably benign	0.01
R8886:Greb1l	UTSW	18	10553843	missense	probably benign	0.21
R8921:Greb1l	UTSW	18	10541825	missense	probably benign	0.01
R8997:Greb1l	UTSW	18	10510747	missense	probably damaging	1.00
R9015:Greb1l	UTSW	18	10541675	missense	probably benign	0.00
R9018:Greb1l	UTSW	18	10542004	missense	possibly damaging	0.76
R9074:Greb1l	UTSW	18	10532797	missense	probably damaging	1.00
R9074:Greb1l	UTSW	18	10558795	missense	probably damaging	1.00
R9117:Greb1l	UTSW	18	10542422	missense	probably benign	0.31
R9189:Greb1l	UTSW	18	10499983	missense	probably benign
R9332:Greb1l	UTSW	18	10532796	missense	possibly damaging	0.92
R9367:Greb1l	UTSW	18	10522130	missense	probably benign	0.00
R9497:Greb1l	UTSW	18	10458600	missense	probably benign	0.00
R9796:Greb1l	UTSW	18	10538233	missense	possibly damaging	0.69
Z1176:Greb1l	UTSW	18	10515305	missense	probably damaging	1.00

Predicted Primers

Posted On

2017-06-26