Incidental Mutation 'R0512:Spag5'
ID 47927
Institutional Source Beutler Lab
Gene Symbol Spag5
Ensembl Gene ENSMUSG00000002055
Gene Name sperm associated antigen 5
Synonyms s17, Astrin, Mastrin, MAP126, Deepest, D11Bhm180e, S17
MMRRC Submission 038706-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0512 (G1)
Quality Score 213
Status Validated
Chromosome 11
Chromosomal Location 78192412-78213283 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) A to G at 78210412 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017534] [ENSMUST00000045026] [ENSMUST00000102478]
AlphaFold Q7TME2
Predicted Effect probably benign
Transcript: ENSMUST00000017534
SMART Domains Protein: ENSMUSP00000017534
Gene: ENSMUSG00000017390

DomainStartEndE-ValueType
Pfam:Glycolytic 15 363 2.6e-185 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045026
SMART Domains Protein: ENSMUSP00000045286
Gene: ENSMUSG00000002055

DomainStartEndE-ValueType
low complexity region 405 420 N/A INTRINSIC
low complexity region 477 493 N/A INTRINSIC
coiled coil region 514 547 N/A INTRINSIC
coiled coil region 638 700 N/A INTRINSIC
coiled coil region 743 854 N/A INTRINSIC
low complexity region 898 912 N/A INTRINSIC
coiled coil region 970 1006 N/A INTRINSIC
coiled coil region 1032 1068 N/A INTRINSIC
coiled coil region 1104 1140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102478
SMART Domains Protein: ENSMUSP00000099536
Gene: ENSMUSG00000017390

DomainStartEndE-ValueType
Pfam:Glycolytic 15 363 5.5e-179 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149711
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (92/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the mitotic spindle apparatus. The encoded protein may be involved in the functional and dynamic regulation of mitotic spindles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are viable and fertile with normal breeding and mating behavio; no abnormalities in male reproductive system anatomy or histology or in spermatogenesis were detectable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik T G 5: 115,001,569 (GRCm39) M22R probably benign Het
Abca8b C A 11: 109,841,476 (GRCm39) M1039I probably benign Het
Actn2 A T 13: 12,292,301 (GRCm39) I653N probably damaging Het
Actr8 G T 14: 29,700,513 (GRCm39) V31L probably benign Het
Adam30 T C 3: 98,069,441 (GRCm39) C425R probably damaging Het
Armc1 A G 3: 19,203,659 (GRCm39) V89A possibly damaging Het
Atr T C 9: 95,817,579 (GRCm39) M2090T probably damaging Het
Braf T A 6: 39,641,923 (GRCm39) probably benign Het
Cant1 A T 11: 118,302,091 (GRCm39) N75K probably benign Het
Chd7 C T 4: 8,805,139 (GRCm39) probably benign Het
Clec16a A G 16: 10,432,444 (GRCm39) Y488C probably damaging Het
Col6a3 A T 1: 90,749,520 (GRCm39) probably benign Het
Col9a2 T A 4: 120,911,504 (GRCm39) M615K probably benign Het
Dedd G A 1: 171,168,498 (GRCm39) R228H probably damaging Het
Dhtkd1 C T 2: 5,908,902 (GRCm39) D731N probably damaging Het
Ercc2 A G 7: 19,127,812 (GRCm39) T651A probably damaging Het
Fam13a T A 6: 58,933,684 (GRCm39) D302V probably damaging Het
Fam193a T C 5: 34,583,735 (GRCm39) S19P probably damaging Het
Fam43a T C 16: 30,420,553 (GRCm39) V379A possibly damaging Het
Fat1 C A 8: 45,404,369 (GRCm39) Y373* probably null Het
Fbxl15 A C 19: 46,317,861 (GRCm39) D181A probably damaging Het
Flt3 A T 5: 147,278,080 (GRCm39) C831* probably null Het
Foxj3 T A 4: 119,443,033 (GRCm39) probably benign Het
Glul T C 1: 153,781,132 (GRCm39) probably benign Het
Gm16380 A T 9: 53,791,529 (GRCm39) noncoding transcript Het
Gm7964 A T 7: 83,405,158 (GRCm39) noncoding transcript Het
Hipk1 A G 3: 103,667,890 (GRCm39) F559S possibly damaging Het
Hnf4g A T 3: 3,716,682 (GRCm39) I284F probably damaging Het
Hoxa13 CCG CCGCG 6: 52,237,618 (GRCm39) probably null Het
Icosl A G 10: 77,907,800 (GRCm39) N120S possibly damaging Het
Ift172 A G 5: 31,442,821 (GRCm39) V155A possibly damaging Het
Kdm4c A G 4: 74,252,031 (GRCm39) E426G probably benign Het
Kif23 A G 9: 61,826,257 (GRCm39) probably benign Het
Krt81 C A 15: 101,361,508 (GRCm39) R24L possibly damaging Het
Lama1 G A 17: 68,086,129 (GRCm39) C1456Y possibly damaging Het
Lamc3 T A 2: 31,827,980 (GRCm39) L1378Q probably damaging Het
Larp1b T A 3: 40,924,469 (GRCm39) L121M probably benign Het
Lepr T A 4: 101,649,216 (GRCm39) D872E probably damaging Het
Lepr A C 4: 101,671,901 (GRCm39) D975A possibly damaging Het
Magi1 A G 6: 93,671,045 (GRCm39) V1068A probably damaging Het
Malt1 T A 18: 65,591,271 (GRCm39) N358K probably damaging Het
Mfap4 T A 11: 61,378,771 (GRCm39) W240R probably damaging Het
Mis18a A G 16: 90,523,244 (GRCm39) V84A possibly damaging Het
Mns1 A G 9: 72,356,753 (GRCm39) E308G possibly damaging Het
Mpp2 C A 11: 101,953,116 (GRCm39) L258F possibly damaging Het
Myh2 A G 11: 67,079,504 (GRCm39) E987G probably damaging Het
Myof A G 19: 37,942,972 (GRCm39) V702A possibly damaging Het
Nhs C A X: 160,620,355 (GRCm39) R1467I probably damaging Het
Nrxn2 A G 19: 6,567,228 (GRCm39) T1360A probably damaging Het
Obox6 A G 7: 15,567,874 (GRCm39) I191T probably benign Het
Pacs2 G T 12: 113,014,547 (GRCm39) R236L probably damaging Het
Pcdhb2 T G 18: 37,429,032 (GRCm39) V335G probably damaging Het
Phyhipl T C 10: 70,404,748 (GRCm39) I140M probably damaging Het
Pkhd1 T C 1: 20,380,738 (GRCm39) probably benign Het
Ppp1r3b T G 8: 35,851,571 (GRCm39) C137G probably damaging Het
Prdm13 T A 4: 21,678,490 (GRCm39) I667F probably damaging Het
Prex2 A G 1: 11,270,157 (GRCm39) M1281V probably benign Het
Rab40b A G 11: 121,250,412 (GRCm39) F81L probably damaging Het
Rb1cc1 T C 1: 6,318,767 (GRCm39) S729P probably damaging Het
Rcl1 A G 19: 29,105,497 (GRCm39) D228G probably damaging Het
Rhbdf1 A T 11: 32,160,875 (GRCm39) C19* probably null Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Rnf150 G A 8: 83,590,807 (GRCm39) V57M probably benign Het
Rp9 A G 9: 22,370,015 (GRCm39) F51L probably benign Het
Sav1 A T 12: 70,015,975 (GRCm39) Y274* probably null Het
Scn4a A T 11: 106,236,503 (GRCm39) D252E probably damaging Het
Scn5a T C 9: 119,379,724 (GRCm39) T187A probably damaging Het
Sigirr T A 7: 140,672,333 (GRCm39) D229V probably benign Het
Slc39a13 T C 2: 90,896,031 (GRCm39) S157G possibly damaging Het
Slc6a20a A G 9: 123,489,471 (GRCm39) S191P probably damaging Het
Sorl1 C A 9: 41,979,128 (GRCm39) A457S probably benign Het
Spon1 A G 7: 113,436,066 (GRCm39) E119G possibly damaging Het
Spred2 T A 11: 19,958,485 (GRCm39) probably benign Het
Sprr3 T G 3: 92,364,784 (GRCm39) Q20P possibly damaging Het
Strn3 A T 12: 51,673,966 (GRCm39) F464L possibly damaging Het
Sun1 A G 5: 139,220,602 (GRCm39) probably benign Het
Sypl2 A G 3: 108,133,486 (GRCm39) W28R possibly damaging Het
Syt5 A T 7: 4,545,813 (GRCm39) V150D probably damaging Het
Tasor T C 14: 27,168,363 (GRCm39) F302L probably damaging Het
Thsd7a A G 6: 12,379,604 (GRCm39) I940T possibly damaging Het
Tlcd3b C T 7: 126,426,795 (GRCm39) R73C probably damaging Het
Tnrc6a T A 7: 122,785,951 (GRCm39) probably benign Het
Trp53 T A 11: 69,479,509 (GRCm39) L203Q probably damaging Het
Tubgcp4 T C 2: 121,005,900 (GRCm39) V96A probably benign Het
Usp17la A G 7: 104,510,246 (GRCm39) T284A possibly damaging Het
Usp34 T C 11: 23,401,997 (GRCm39) M2409T probably benign Het
Vmn2r100 C A 17: 19,742,382 (GRCm39) P252Q possibly damaging Het
Vmn2r56 A G 7: 12,449,350 (GRCm39) I296T probably benign Het
Vmn2r67 A G 7: 84,799,900 (GRCm39) V446A probably damaging Het
Zfp217 C T 2: 169,957,382 (GRCm39) A539T probably benign Het
Zfp267 T C 3: 36,220,262 (GRCm39) C762R probably damaging Het
Other mutations in Spag5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Spag5 APN 11 78,195,443 (GRCm39) missense possibly damaging 0.62
IGL01820:Spag5 APN 11 78,195,085 (GRCm39) missense probably benign 0.06
IGL02066:Spag5 APN 11 78,195,358 (GRCm39) missense probably benign
IGL02140:Spag5 APN 11 78,206,459 (GRCm39) missense possibly damaging 0.62
IGL02251:Spag5 APN 11 78,210,860 (GRCm39) missense probably damaging 1.00
IGL02452:Spag5 APN 11 78,195,449 (GRCm39) missense probably benign 0.08
IGL02658:Spag5 APN 11 78,212,157 (GRCm39) nonsense probably null
boyardee UTSW 11 78,204,017 (GRCm39) critical splice donor site probably null
Franco UTSW 11 78,205,008 (GRCm39) nonsense probably null
spaghetto UTSW 11 78,204,205 (GRCm39) nonsense probably null
IGL02991:Spag5 UTSW 11 78,205,077 (GRCm39) missense probably damaging 0.99
R0477:Spag5 UTSW 11 78,205,024 (GRCm39) missense probably damaging 1.00
R0535:Spag5 UTSW 11 78,195,554 (GRCm39) missense probably benign 0.00
R0557:Spag5 UTSW 11 78,205,037 (GRCm39) missense probably damaging 0.99
R0584:Spag5 UTSW 11 78,194,921 (GRCm39) missense possibly damaging 0.49
R0666:Spag5 UTSW 11 78,204,222 (GRCm39) missense probably damaging 1.00
R0723:Spag5 UTSW 11 78,210,410 (GRCm39) unclassified probably benign
R1413:Spag5 UTSW 11 78,196,143 (GRCm39) nonsense probably null
R1680:Spag5 UTSW 11 78,211,442 (GRCm39) missense probably damaging 1.00
R1687:Spag5 UTSW 11 78,195,755 (GRCm39) missense probably benign 0.32
R1696:Spag5 UTSW 11 78,212,152 (GRCm39) missense probably damaging 1.00
R1831:Spag5 UTSW 11 78,205,082 (GRCm39) missense probably benign 0.08
R1866:Spag5 UTSW 11 78,195,281 (GRCm39) missense possibly damaging 0.62
R1918:Spag5 UTSW 11 78,195,002 (GRCm39) missense probably benign 0.01
R4004:Spag5 UTSW 11 78,212,355 (GRCm39) missense probably benign 0.22
R4005:Spag5 UTSW 11 78,212,355 (GRCm39) missense probably benign 0.22
R4222:Spag5 UTSW 11 78,195,337 (GRCm39) missense probably damaging 1.00
R4750:Spag5 UTSW 11 78,210,878 (GRCm39) missense probably benign 0.00
R4771:Spag5 UTSW 11 78,195,592 (GRCm39) missense probably damaging 1.00
R4928:Spag5 UTSW 11 78,205,199 (GRCm39) missense probably damaging 0.97
R5360:Spag5 UTSW 11 78,205,588 (GRCm39) missense probably damaging 0.99
R5366:Spag5 UTSW 11 78,211,152 (GRCm39) splice site probably null
R5618:Spag5 UTSW 11 78,194,906 (GRCm39) missense probably benign 0.00
R5668:Spag5 UTSW 11 78,195,542 (GRCm39) missense possibly damaging 0.53
R5762:Spag5 UTSW 11 78,194,972 (GRCm39) missense probably benign 0.25
R5859:Spag5 UTSW 11 78,204,360 (GRCm39) missense probably benign 0.38
R6564:Spag5 UTSW 11 78,206,401 (GRCm39) missense probably damaging 1.00
R6571:Spag5 UTSW 11 78,212,095 (GRCm39) missense probably damaging 1.00
R6573:Spag5 UTSW 11 78,205,008 (GRCm39) nonsense probably null
R7074:Spag5 UTSW 11 78,195,868 (GRCm39) critical splice donor site probably null
R7091:Spag5 UTSW 11 78,204,017 (GRCm39) critical splice donor site probably null
R7332:Spag5 UTSW 11 78,204,205 (GRCm39) nonsense probably null
R8073:Spag5 UTSW 11 78,192,803 (GRCm39) missense probably benign 0.22
R8709:Spag5 UTSW 11 78,192,738 (GRCm39) missense probably benign
R8723:Spag5 UTSW 11 78,212,215 (GRCm39) missense probably damaging 1.00
R8976:Spag5 UTSW 11 78,195,413 (GRCm39) missense probably benign 0.01
R9053:Spag5 UTSW 11 78,212,575 (GRCm39) missense probably benign 0.14
R9142:Spag5 UTSW 11 78,192,823 (GRCm39) missense possibly damaging 0.56
Z1176:Spag5 UTSW 11 78,205,808 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CACCCTGGAAGGACAATTCAGAGC -3'
(R):5'- TTCCAAGCAATGGCACAGGAGC -3'

Sequencing Primer
(F):5'- TGATCTAAAGTTGTAAAGTACAGCGG -3'
(R):5'- caccagaagagggcatcag -3'
Posted On 2013-06-12