Mutagenetix > Incidental Mutation

Incidental Mutation 'R0512:Spag5'

47927

Institutional Source

Beutler Lab

Gene Symbol

Spag5

Ensembl Gene

ENSMUSG00000002055

Gene Name

sperm associated antigen 5

Synonyms

D11Bhm180e, Astrin, MAP126, Deepest, Mastrin, S17, s17

MMRRC Submission

038706-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0512 (G1)

Quality Score

213

Status

Validated

Chromosome

Chromosomal Location

78301529-78322457 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

A to G at 78319586 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000099536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017534] [ENSMUST00000045026] [ENSMUST00000102478]

AlphaFold

Q7TME2

Predicted Effect

probably benign
Transcript: ENSMUST00000017534

SMART Domains

Protein: ENSMUSP00000017534
Gene: ENSMUSG00000017390

Domain	Start	End	E-Value	Type
Pfam:Glycolytic	15	363	2.6e-185	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000045026

SMART Domains

Protein: ENSMUSP00000045286
Gene: ENSMUSG00000002055

Domain	Start	End	E-Value	Type
low complexity region	405	420	N/A	INTRINSIC
low complexity region	477	493	N/A	INTRINSIC
coiled coil region	514	547	N/A	INTRINSIC
coiled coil region	638	700	N/A	INTRINSIC
coiled coil region	743	854	N/A	INTRINSIC
low complexity region	898	912	N/A	INTRINSIC
coiled coil region	970	1006	N/A	INTRINSIC
coiled coil region	1032	1068	N/A	INTRINSIC
coiled coil region	1104	1140	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102478

SMART Domains

Protein: ENSMUSP00000099536
Gene: ENSMUSG00000017390

Domain	Start	End	E-Value	Type
Pfam:Glycolytic	15	363	5.5e-179	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125477

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128032

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128359

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133579

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146068

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148689

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149711

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150016

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.8%

Validation Efficiency

100% (92/92)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the mitotic spindle apparatus. The encoded protein may be involved in the functional and dynamic regulation of mitotic spindles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are viable and fertile with normal breeding and mating behavio; no abnormalities in male reproductive system anatomy or histology or in spermatogenesis were detectable. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930519G04Rik	T	G	5: 114,863,508	M22R	probably benign	Het
Abca8b	C	A	11: 109,950,650	M1039I	probably benign	Het
Actn2	A	T	13: 12,277,415	I653N	probably damaging	Het
Actr8	G	T	14: 29,978,556	V31L	probably benign	Het
Adam30	T	C	3: 98,162,125	C425R	probably damaging	Het
Armc1	A	G	3: 19,149,495	V89A	possibly damaging	Het
Atr	T	C	9: 95,935,526	M2090T	probably damaging	Het
Braf	T	A	6: 39,664,989		probably benign	Het
Cant1	A	T	11: 118,411,265	N75K	probably benign	Het
Chd7	C	T	4: 8,805,139		probably benign	Het
Clec16a	A	G	16: 10,614,580	Y488C	probably damaging	Het
Col6a3	A	T	1: 90,821,798		probably benign	Het
Col9a2	T	A	4: 121,054,307	M615K	probably benign	Het
D3Ertd254e	T	C	3: 36,166,113	C762R	probably damaging	Het
Dedd	G	A	1: 171,340,930	R228H	probably damaging	Het
Dhtkd1	C	T	2: 5,904,091	D731N	probably damaging	Het
Ercc2	A	G	7: 19,393,887	T651A	probably damaging	Het
Fam13a	T	A	6: 58,956,699	D302V	probably damaging	Het
Fam193a	T	C	5: 34,426,391	S19P	probably damaging	Het
Fam208a	T	C	14: 27,446,406	F302L	probably damaging	Het
Fam43a	T	C	16: 30,601,735	V379A	possibly damaging	Het
Fam57b	C	T	7: 126,827,623	R73C	probably damaging	Het
Fat1	C	A	8: 44,951,332	Y373*	probably null	Het
Fbxl15	A	C	19: 46,329,422	D181A	probably damaging	Het
Flt3	A	T	5: 147,341,270	C831*	probably null	Het
Foxj3	T	A	4: 119,585,836		probably benign	Het
Glul	T	C	1: 153,905,386		probably benign	Het
Gm16380	A	T	9: 53,884,245		noncoding transcript	Het
Gm7964	A	T	7: 83,755,950		noncoding transcript	Het
Hipk1	A	G	3: 103,760,574	F559S	possibly damaging	Het
Hnf4g	A	T	3: 3,651,622	I284F	probably damaging	Het
Hoxa13	CCG	CCGCG	6: 52,260,635		probably null	Het
Icosl	A	G	10: 78,071,966	N120S	possibly damaging	Het
Ift172	A	G	5: 31,285,477	V155A	possibly damaging	Het
Kdm4c	A	G	4: 74,333,794	E426G	probably benign	Het
Kif23	A	G	9: 61,918,975		probably benign	Het
Krt81	C	A	15: 101,463,627	R24L	possibly damaging	Het
Lama1	G	A	17: 67,779,134	C1456Y	possibly damaging	Het
Lamc3	T	A	2: 31,937,968	L1378Q	probably damaging	Het
Larp1b	T	A	3: 40,970,034	L121M	probably benign	Het
Lepr	T	A	4: 101,792,019	D872E	probably damaging	Het
Lepr	A	C	4: 101,814,704	D975A	possibly damaging	Het
Magi1	A	G	6: 93,694,064	V1068A	probably damaging	Het
Malt1	T	A	18: 65,458,200	N358K	probably damaging	Het
Mfap4	T	A	11: 61,487,945	W240R	probably damaging	Het
Mis18a	A	G	16: 90,726,356	V84A	possibly damaging	Het
Mns1	A	G	9: 72,449,471	E308G	possibly damaging	Het
Mpp2	C	A	11: 102,062,290	L258F	possibly damaging	Het
Myh2	A	G	11: 67,188,678	E987G	probably damaging	Het
Myof	A	G	19: 37,954,524	V702A	possibly damaging	Het
Nhs	C	A	X: 161,837,359	R1467I	probably damaging	Het
Nrxn2	A	G	19: 6,517,198	T1360A	probably damaging	Het
Obox6	A	G	7: 15,833,949	I191T	probably benign	Het
Pacs2	G	T	12: 113,050,927	R236L	probably damaging	Het
Pcdhb2	T	G	18: 37,295,979	V335G	probably damaging	Het
Phyhipl	T	C	10: 70,568,918	I140M	probably damaging	Het
Pkhd1	T	C	1: 20,310,514		probably benign	Het
Ppp1r3b	T	G	8: 35,384,417	C137G	probably damaging	Het
Prdm13	T	A	4: 21,678,490	I667F	probably damaging	Het
Prex2	A	G	1: 11,199,933	M1281V	probably benign	Het
Rab40b	A	G	11: 121,359,586	F81L	probably damaging	Het
Rb1cc1	T	C	1: 6,248,543	S729P	probably damaging	Het
Rcl1	A	G	19: 29,128,097	D228G	probably damaging	Het
Rhbdf1	A	T	11: 32,210,875	C19*	probably null	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rnf150	G	A	8: 82,864,178	V57M	probably benign	Het
Rp9	A	G	9: 22,458,719	F51L	probably benign	Het
Sav1	A	T	12: 69,969,201	Y274*	probably null	Het
Scn4a	A	T	11: 106,345,677	D252E	probably damaging	Het
Scn5a	T	C	9: 119,550,658	T187A	probably damaging	Het
Sigirr	T	A	7: 141,092,420	D229V	probably benign	Het
Slc39a13	T	C	2: 91,065,686	S157G	possibly damaging	Het
Slc6a20a	A	G	9: 123,660,406	S191P	probably damaging	Het
Sorl1	C	A	9: 42,067,832	A457S	probably benign	Het
Spon1	A	G	7: 113,836,833	E119G	possibly damaging	Het
Spred2	T	A	11: 20,008,485		probably benign	Het
Sprr3	T	G	3: 92,457,477	Q20P	possibly damaging	Het
Strn3	A	T	12: 51,627,183	F464L	possibly damaging	Het
Sun1	A	G	5: 139,234,847		probably benign	Het
Sypl2	A	G	3: 108,226,170	W28R	possibly damaging	Het
Syt5	A	T	7: 4,542,814	V150D	probably damaging	Het
Thsd7a	A	G	6: 12,379,605	I940T	possibly damaging	Het
Tnrc6a	T	A	7: 123,186,728		probably benign	Het
Trp53	T	A	11: 69,588,683	L203Q	probably damaging	Het
Tubgcp4	T	C	2: 121,175,419	V96A	probably benign	Het
Usp17la	A	G	7: 104,861,039	T284A	possibly damaging	Het
Usp34	T	C	11: 23,451,997	M2409T	probably benign	Het
Vmn2r100	C	A	17: 19,522,120	P252Q	possibly damaging	Het
Vmn2r56	A	G	7: 12,715,423	I296T	probably benign	Het
Vmn2r67	A	G	7: 85,150,692	V446A	probably damaging	Het
Zfp217	C	T	2: 170,115,462	A539T	probably benign	Het

Other mutations in Spag5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01380:Spag5	APN	11	78304617	missense	possibly damaging	0.62
IGL01820:Spag5	APN	11	78304259	missense	probably benign	0.06
IGL02066:Spag5	APN	11	78304532	missense	probably benign
IGL02140:Spag5	APN	11	78315633	missense	possibly damaging	0.62
IGL02251:Spag5	APN	11	78320034	missense	probably damaging	1.00
IGL02452:Spag5	APN	11	78304623	missense	probably benign	0.08
IGL02658:Spag5	APN	11	78321331	nonsense	probably null
boyardee	UTSW	11	78313191	critical splice donor site	probably null
Franco	UTSW	11	78314182	nonsense	probably null
spaghetto	UTSW	11	78313379	nonsense	probably null
IGL02991:Spag5	UTSW	11	78314251	missense	probably damaging	0.99
R0477:Spag5	UTSW	11	78314198	missense	probably damaging	1.00
R0535:Spag5	UTSW	11	78304728	missense	probably benign	0.00
R0557:Spag5	UTSW	11	78314211	missense	probably damaging	0.99
R0584:Spag5	UTSW	11	78304095	missense	possibly damaging	0.49
R0666:Spag5	UTSW	11	78313396	missense	probably damaging	1.00
R0723:Spag5	UTSW	11	78319584	unclassified	probably benign
R1413:Spag5	UTSW	11	78305317	nonsense	probably null
R1680:Spag5	UTSW	11	78320616	missense	probably damaging	1.00
R1687:Spag5	UTSW	11	78304929	missense	probably benign	0.32
R1696:Spag5	UTSW	11	78321326	missense	probably damaging	1.00
R1831:Spag5	UTSW	11	78314256	missense	probably benign	0.08
R1866:Spag5	UTSW	11	78304455	missense	possibly damaging	0.62
R1918:Spag5	UTSW	11	78304176	missense	probably benign	0.01
R4004:Spag5	UTSW	11	78321529	missense	probably benign	0.22
R4005:Spag5	UTSW	11	78321529	missense	probably benign	0.22
R4222:Spag5	UTSW	11	78304511	missense	probably damaging	1.00
R4750:Spag5	UTSW	11	78320052	missense	probably benign	0.00
R4771:Spag5	UTSW	11	78304766	missense	probably damaging	1.00
R4928:Spag5	UTSW	11	78314373	missense	probably damaging	0.97
R5360:Spag5	UTSW	11	78314762	missense	probably damaging	0.99
R5366:Spag5	UTSW	11	78320326	splice site	probably null
R5618:Spag5	UTSW	11	78304080	missense	probably benign	0.00
R5668:Spag5	UTSW	11	78304716	missense	possibly damaging	0.53
R5762:Spag5	UTSW	11	78304146	missense	probably benign	0.25
R5859:Spag5	UTSW	11	78313534	missense	probably benign	0.38
R6564:Spag5	UTSW	11	78315575	missense	probably damaging	1.00
R6571:Spag5	UTSW	11	78321269	missense	probably damaging	1.00
R6573:Spag5	UTSW	11	78314182	nonsense	probably null
R7074:Spag5	UTSW	11	78305042	critical splice donor site	probably null
R7091:Spag5	UTSW	11	78313191	critical splice donor site	probably null
R7332:Spag5	UTSW	11	78313379	nonsense	probably null
R8073:Spag5	UTSW	11	78301977	missense	probably benign	0.22
R8709:Spag5	UTSW	11	78301912	missense	probably benign
R8723:Spag5	UTSW	11	78321389	missense	probably damaging	1.00
R8976:Spag5	UTSW	11	78304587	missense	probably benign	0.01
R9053:Spag5	UTSW	11	78321749	missense	probably benign	0.14
R9142:Spag5	UTSW	11	78301997	missense	possibly damaging	0.56
Z1176:Spag5	UTSW	11	78314982	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- CACCCTGGAAGGACAATTCAGAGC -3'
(R):5'- TTCCAAGCAATGGCACAGGAGC -3'

Sequencing Primer
(F):5'- TGATCTAAAGTTGTAAAGTACAGCGG -3'
(R):5'- caccagaagagggcatcag -3'

Posted On

2013-06-12