Incidental Mutation 'R0512:Abca8b'
ID47930
Institutional Source Beutler Lab
Gene Symbol Abca8b
Ensembl Gene ENSMUSG00000020620
Gene NameATP-binding cassette, sub-family A (ABC1), member 8b
SynonymsAbca8
MMRRC Submission 038706-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0512 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location109932190-109995845 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 109950650 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 1039 (M1039I)
Ref Sequence ENSEMBL: ENSMUSP00000020948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020948] [ENSMUST00000106669]
Predicted Effect probably benign
Transcript: ENSMUST00000020948
AA Change: M1039I

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000020948
Gene: ENSMUSG00000020620
AA Change: M1039I

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 417 3.9e-28 PFAM
AAA 507 691 6.36e-10 SMART
Pfam:ABC2_membrane_3 859 1215 1e-10 PFAM
low complexity region 1246 1255 N/A INTRINSIC
AAA 1313 1492 6.17e-8 SMART
low complexity region 1597 1607 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106669
AA Change: M977I

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000102280
Gene: ENSMUSG00000020620
AA Change: M977I

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 344 2.6e-16 PFAM
AAA 445 629 6.36e-10 SMART
transmembrane domain 798 815 N/A INTRINSIC
transmembrane domain 1001 1023 N/A INTRINSIC
transmembrane domain 1038 1060 N/A INTRINSIC
transmembrane domain 1072 1091 N/A INTRINSIC
transmembrane domain 1101 1123 N/A INTRINSIC
transmembrane domain 1136 1158 N/A INTRINSIC
low complexity region 1184 1193 N/A INTRINSIC
AAA 1251 1430 6.17e-8 SMART
low complexity region 1535 1545 N/A INTRINSIC
Meta Mutation Damage Score 0.22 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (92/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The encoded protein may regulate lipid metabolism and be involved in the formation and maintenance of myelin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik T G 5: 114,863,508 M22R probably benign Het
Actn2 A T 13: 12,277,415 I653N probably damaging Het
Actr8 G T 14: 29,978,556 V31L probably benign Het
Adam30 T C 3: 98,162,125 C425R probably damaging Het
Armc1 A G 3: 19,149,495 V89A possibly damaging Het
Atr T C 9: 95,935,526 M2090T probably damaging Het
Braf T A 6: 39,664,989 probably benign Het
Cant1 A T 11: 118,411,265 N75K probably benign Het
Chd7 C T 4: 8,805,139 probably benign Het
Clec16a A G 16: 10,614,580 Y488C probably damaging Het
Col6a3 A T 1: 90,821,798 probably benign Het
Col9a2 T A 4: 121,054,307 M615K probably benign Het
D3Ertd254e T C 3: 36,166,113 C762R probably damaging Het
Dedd G A 1: 171,340,930 R228H probably damaging Het
Dhtkd1 C T 2: 5,904,091 D731N probably damaging Het
Ercc2 A G 7: 19,393,887 T651A probably damaging Het
Fam13a T A 6: 58,956,699 D302V probably damaging Het
Fam193a T C 5: 34,426,391 S19P probably damaging Het
Fam208a T C 14: 27,446,406 F302L probably damaging Het
Fam43a T C 16: 30,601,735 V379A possibly damaging Het
Fam57b C T 7: 126,827,623 R73C probably damaging Het
Fat1 C A 8: 44,951,332 Y373* probably null Het
Fbxl15 A C 19: 46,329,422 D181A probably damaging Het
Flt3 A T 5: 147,341,270 C831* probably null Het
Foxj3 T A 4: 119,585,836 probably benign Het
Glul T C 1: 153,905,386 probably benign Het
Gm16380 A T 9: 53,884,245 noncoding transcript Het
Gm7964 A T 7: 83,755,950 noncoding transcript Het
Hipk1 A G 3: 103,760,574 F559S possibly damaging Het
Hnf4g A T 3: 3,651,622 I284F probably damaging Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Icosl A G 10: 78,071,966 N120S possibly damaging Het
Ift172 A G 5: 31,285,477 V155A possibly damaging Het
Kdm4c A G 4: 74,333,794 E426G probably benign Het
Kif23 A G 9: 61,918,975 probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lama1 G A 17: 67,779,134 C1456Y possibly damaging Het
Lamc3 T A 2: 31,937,968 L1378Q probably damaging Het
Larp1b T A 3: 40,970,034 L121M probably benign Het
Lepr T A 4: 101,792,019 D872E probably damaging Het
Lepr A C 4: 101,814,704 D975A possibly damaging Het
Magi1 A G 6: 93,694,064 V1068A probably damaging Het
Malt1 T A 18: 65,458,200 N358K probably damaging Het
Mfap4 T A 11: 61,487,945 W240R probably damaging Het
Mis18a A G 16: 90,726,356 V84A possibly damaging Het
Mns1 A G 9: 72,449,471 E308G possibly damaging Het
Mpp2 C A 11: 102,062,290 L258F possibly damaging Het
Myh2 A G 11: 67,188,678 E987G probably damaging Het
Myof A G 19: 37,954,524 V702A possibly damaging Het
Nhs C A X: 161,837,359 R1467I probably damaging Het
Nrxn2 A G 19: 6,517,198 T1360A probably damaging Het
Obox6 A G 7: 15,833,949 I191T probably benign Het
Pacs2 G T 12: 113,050,927 R236L probably damaging Het
Pcdhb2 T G 18: 37,295,979 V335G probably damaging Het
Phyhipl T C 10: 70,568,918 I140M probably damaging Het
Pkhd1 T C 1: 20,310,514 probably benign Het
Ppp1r3b T G 8: 35,384,417 C137G probably damaging Het
Prdm13 T A 4: 21,678,490 I667F probably damaging Het
Prex2 A G 1: 11,199,933 M1281V probably benign Het
Rab40b A G 11: 121,359,586 F81L probably damaging Het
Rb1cc1 T C 1: 6,248,543 S729P probably damaging Het
Rcl1 A G 19: 29,128,097 D228G probably damaging Het
Rhbdf1 A T 11: 32,210,875 C19* probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf150 G A 8: 82,864,178 V57M probably benign Het
Rp9 A G 9: 22,458,719 F51L probably benign Het
Sav1 A T 12: 69,969,201 Y274* probably null Het
Scn4a A T 11: 106,345,677 D252E probably damaging Het
Scn5a T C 9: 119,550,658 T187A probably damaging Het
Sigirr T A 7: 141,092,420 D229V probably benign Het
Slc39a13 T C 2: 91,065,686 S157G possibly damaging Het
Slc6a20a A G 9: 123,660,406 S191P probably damaging Het
Sorl1 C A 9: 42,067,832 A457S probably benign Het
Spag5 A G 11: 78,319,586 probably benign Het
Spon1 A G 7: 113,836,833 E119G possibly damaging Het
Spred2 T A 11: 20,008,485 probably benign Het
Sprr3 T G 3: 92,457,477 Q20P possibly damaging Het
Strn3 A T 12: 51,627,183 F464L possibly damaging Het
Sun1 A G 5: 139,234,847 probably benign Het
Sypl2 A G 3: 108,226,170 W28R possibly damaging Het
Syt5 A T 7: 4,542,814 V150D probably damaging Het
Thsd7a A G 6: 12,379,605 I940T possibly damaging Het
Tnrc6a T A 7: 123,186,728 probably benign Het
Trp53 T A 11: 69,588,683 L203Q probably damaging Het
Tubgcp4 T C 2: 121,175,419 V96A probably benign Het
Usp17la A G 7: 104,861,039 T284A possibly damaging Het
Usp34 T C 11: 23,451,997 M2409T probably benign Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r56 A G 7: 12,715,423 I296T probably benign Het
Vmn2r67 A G 7: 85,150,692 V446A probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Other mutations in Abca8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00862:Abca8b APN 11 109953548 missense possibly damaging 0.66
IGL00952:Abca8b APN 11 109969060 critical splice donor site probably null
IGL01141:Abca8b APN 11 109937730 missense probably damaging 1.00
IGL01523:Abca8b APN 11 109976494 missense probably damaging 1.00
IGL01633:Abca8b APN 11 109936754 missense probably damaging 0.99
IGL01862:Abca8b APN 11 109947171 nonsense probably null
IGL01963:Abca8b APN 11 109971763 missense probably damaging 0.99
IGL02169:Abca8b APN 11 109952582 missense probably damaging 0.98
IGL02536:Abca8b APN 11 109981748 missense probably benign 0.02
IGL02658:Abca8b APN 11 109952560 missense probably benign
IGL02828:Abca8b APN 11 109980894 missense probably damaging 0.99
IGL03118:Abca8b APN 11 109947181 missense possibly damaging 0.66
IGL03302:Abca8b APN 11 109967750 missense possibly damaging 0.80
IGL03325:Abca8b APN 11 109953596 missense possibly damaging 0.94
R0057:Abca8b UTSW 11 109941559 missense possibly damaging 0.91
R0131:Abca8b UTSW 11 109942289 missense possibly damaging 0.46
R0226:Abca8b UTSW 11 109957018 intron probably null
R0426:Abca8b UTSW 11 109955027 splice site probably benign
R0432:Abca8b UTSW 11 109980015 missense possibly damaging 0.94
R0589:Abca8b UTSW 11 109942268 missense probably damaging 0.96
R0690:Abca8b UTSW 11 109969808 splice site probably benign
R1263:Abca8b UTSW 11 109941607 missense possibly damaging 0.66
R1371:Abca8b UTSW 11 109953553 missense probably damaging 0.99
R1497:Abca8b UTSW 11 109973821 splice site probably benign
R1502:Abca8b UTSW 11 109974645 missense probably damaging 1.00
R1517:Abca8b UTSW 11 109971814 missense possibly damaging 0.66
R1543:Abca8b UTSW 11 109974674 missense probably damaging 0.98
R1618:Abca8b UTSW 11 109949888 splice site probably benign
R1625:Abca8b UTSW 11 109967121 missense probably benign 0.11
R1753:Abca8b UTSW 11 109973716 missense probably benign 0.00
R1819:Abca8b UTSW 11 109981056 critical splice acceptor site probably null
R1822:Abca8b UTSW 11 109957075 missense possibly damaging 0.92
R1829:Abca8b UTSW 11 109942341 missense probably damaging 0.97
R1873:Abca8b UTSW 11 109979955 missense probably benign 0.01
R1899:Abca8b UTSW 11 109937918 missense possibly damaging 0.92
R1908:Abca8b UTSW 11 109957098 missense possibly damaging 0.92
R1962:Abca8b UTSW 11 109979898 missense probably benign 0.00
R1984:Abca8b UTSW 11 109977841 missense probably damaging 1.00
R2035:Abca8b UTSW 11 109957106 missense possibly damaging 0.94
R2092:Abca8b UTSW 11 109966708 missense possibly damaging 0.63
R2100:Abca8b UTSW 11 109937782 missense probably damaging 1.00
R2267:Abca8b UTSW 11 109955148 missense probably benign 0.03
R2871:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2871:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2872:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2872:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2873:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R3711:Abca8b UTSW 11 109946255 missense possibly damaging 0.46
R3937:Abca8b UTSW 11 109974567 missense probably benign 0.01
R4052:Abca8b UTSW 11 109981725 nonsense probably null
R4060:Abca8b UTSW 11 109957201 missense probably benign 0.04
R4207:Abca8b UTSW 11 109981725 nonsense probably null
R4208:Abca8b UTSW 11 109981725 nonsense probably null
R4354:Abca8b UTSW 11 109971692 missense probably benign 0.27
R4399:Abca8b UTSW 11 109936385 missense possibly damaging 0.66
R4456:Abca8b UTSW 11 109942245 missense probably benign 0.27
R4509:Abca8b UTSW 11 109966755 missense probably damaging 1.00
R4672:Abca8b UTSW 11 109936448 missense possibly damaging 0.81
R4868:Abca8b UTSW 11 109974512 missense probably benign 0.05
R5002:Abca8b UTSW 11 109961797 missense probably damaging 0.96
R5007:Abca8b UTSW 11 109936764 missense probably damaging 1.00
R5014:Abca8b UTSW 11 109950131 missense probably damaging 0.98
R5023:Abca8b UTSW 11 109974988 critical splice donor site probably null
R5091:Abca8b UTSW 11 109936384 missense possibly damaging 0.92
R5098:Abca8b UTSW 11 109957118 missense probably benign 0.05
R5117:Abca8b UTSW 11 109966803 missense probably damaging 1.00
R5234:Abca8b UTSW 11 109976594 missense possibly damaging 0.90
R5302:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5307:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5487:Abca8b UTSW 11 109953514 missense probably damaging 0.99
R5512:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5564:Abca8b UTSW 11 109934581 missense probably benign 0.08
R5610:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5677:Abca8b UTSW 11 109940861 missense probably damaging 1.00
R5723:Abca8b UTSW 11 109953619 missense possibly damaging 0.90
R5827:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5829:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5848:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5849:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5850:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5854:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5982:Abca8b UTSW 11 109953597 missense possibly damaging 0.80
R5994:Abca8b UTSW 11 109949766 splice site probably null
R6035:Abca8b UTSW 11 109971860 splice site probably null
R6035:Abca8b UTSW 11 109971860 splice site probably null
R6050:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R6145:Abca8b UTSW 11 109973808 missense probably benign 0.03
R6223:Abca8b UTSW 11 109977846 missense probably benign 0.00
R6349:Abca8b UTSW 11 109934718 splice site probably null
R7002:Abca8b UTSW 11 109941564 missense probably damaging 1.00
R7050:Abca8b UTSW 11 109973718 missense possibly damaging 0.90
R7107:Abca8b UTSW 11 109976473 missense probably damaging 0.98
R7158:Abca8b UTSW 11 109934589 missense probably damaging 1.00
R7170:Abca8b UTSW 11 109945828 missense probably benign 0.09
R7197:Abca8b UTSW 11 109945822 nonsense probably null
R7220:Abca8b UTSW 11 109981717 missense probably damaging 1.00
R7512:Abca8b UTSW 11 109938449 missense probably benign 0.01
Z1088:Abca8b UTSW 11 109976482 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TACAGGGGAATGTCCACCATTGCC -3'
(R):5'- ACTGTGAAAAGTTTGGAGGTTCCAACA -3'

Sequencing Primer
(F):5'- CACAAAGTGTGGCTTCAGC -3'
(R):5'- GTTTGGAGGTTCCAACAAGACATAC -3'
Posted On2013-06-12