Incidental Mutation 'R6005:Lrrfip1'
ID479385
Institutional Source Beutler Lab
Gene Symbol Lrrfip1
Ensembl Gene ENSMUSG00000026305
Gene Nameleucine rich repeat (in FLII) interacting protein 1
SynonymsFliiap1, FLAP (FLI LRR associated protein)
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6005 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location90998737-91128944 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91114611 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 246 (V246A)
Ref Sequence ENSEMBL: ENSMUSP00000095254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068116] [ENSMUST00000068167] [ENSMUST00000097649] [ENSMUST00000097650] [ENSMUST00000185531] [ENSMUST00000189617]
Predicted Effect probably benign
Transcript: ENSMUST00000068116
SMART Domains Protein: ENSMUSP00000065850
Gene: ENSMUSG00000026305

DomainStartEndE-ValueType
Pfam:DUF2051 33 354 4.1e-133 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068167
SMART Domains Protein: ENSMUSP00000063878
Gene: ENSMUSG00000026305

DomainStartEndE-ValueType
Pfam:DUF2051 23 123 2.2e-18 PFAM
Pfam:DUF2051 193 387 2.5e-49 PFAM
Pfam:DUF2051 366 553 8.1e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097649
AA Change: V246A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095254
Gene: ENSMUSG00000026305
AA Change: V246A

DomainStartEndE-ValueType
Pfam:DUF2051 23 327 1.3e-87 PFAM
internal_repeat_2 439 528 6e-5 PROSPERO
low complexity region 550 566 N/A INTRINSIC
internal_repeat_2 575 683 6e-5 PROSPERO
internal_repeat_1 647 715 1.05e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000097650
SMART Domains Protein: ENSMUSP00000095255
Gene: ENSMUSG00000026305

DomainStartEndE-ValueType
Pfam:DUF2051 23 120 2.3e-16 PFAM
Pfam:DUF2051 195 368 1.2e-63 PFAM
Pfam:DUF2051 379 554 1.8e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185531
SMART Domains Protein: ENSMUSP00000139497
Gene: ENSMUSG00000026305

DomainStartEndE-ValueType
Pfam:DUF2051 33 118 1.2e-12 PFAM
low complexity region 138 158 N/A INTRINSIC
Pfam:DUF2051 231 413 3.7e-60 PFAM
Pfam:DUF2051 424 575 1.3e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188708
Predicted Effect probably benign
Transcript: ENSMUST00000189617
SMART Domains Protein: ENSMUSP00000139811
Gene: ENSMUSG00000026305

DomainStartEndE-ValueType
Pfam:DUF2051 23 108 1.4e-12 PFAM
low complexity region 128 148 N/A INTRINSIC
Pfam:DUF2051 229 403 1.2e-60 PFAM
Pfam:DUF2051 414 589 1.8e-44 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 90.9%
Validation Efficiency 99% (79/80)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810006K23Rik G T 5: 124,340,774 E153* probably null Het
4930412O13Rik T C 2: 9,882,827 probably benign Het
7530416G11Rik A T 15: 85,494,109 I111N unknown Het
Adgb C T 10: 10,395,352 R849H probably damaging Het
Ahnak T C 19: 9,015,161 V4603A possibly damaging Het
AI464131 T A 4: 41,498,895 H245L probably benign Het
Ank1 A G 8: 23,132,202 D1589G probably damaging Het
Ankrd2 A G 19: 42,040,115 D70G probably damaging Het
Arid2 T C 15: 96,370,972 S989P probably benign Het
Bbs1 A T 19: 4,903,795 Y113* probably null Het
Bfsp2 T G 9: 103,448,550 K298T probably damaging Het
Bpi G A 2: 158,262,480 V168I possibly damaging Het
Cacna2d1 T C 5: 16,361,821 S921P probably damaging Het
Clec4d A C 6: 123,267,159 T76P probably damaging Het
Coq8b C T 7: 27,257,325 Q468* probably null Het
Dennd6b T C 15: 89,188,168 E248G possibly damaging Het
Ednra A G 8: 77,674,927 S245P possibly damaging Het
Epb41l4a C T 18: 33,828,143 C446Y probably benign Het
Fam221a A G 6: 49,367,822 probably benign Het
Fam229a T C 4: 129,491,503 S76P probably benign Het
Fryl C T 5: 73,083,295 D1321N probably damaging Het
Gli2 C T 1: 118,842,064 R586H probably damaging Het
Gm13089 T A 4: 143,698,432 H147L probably benign Het
Gm94 C T 18: 43,792,797 A16T possibly damaging Het
Gorasp2 T C 2: 70,690,751 V355A probably benign Het
Grid1 C A 14: 35,323,412 T404N probably damaging Het
Gtf2i C A 5: 134,255,958 E475* probably null Het
Gucy1a2 T C 9: 3,865,518 probably null Het
Hs3st5 T A 10: 36,832,928 I153N probably damaging Het
Il11ra1 T C 4: 41,763,887 probably null Het
Ireb2 G A 9: 54,908,805 G887S probably damaging Het
Kdsr T C 1: 106,734,581 E248G probably benign Het
Lemd2 C G 17: 27,190,785 R464P probably damaging Het
Macf1 T A 4: 123,474,275 D2231V possibly damaging Het
Map2k5 C T 9: 63,281,019 D283N probably damaging Het
Mfsd5 A G 15: 102,281,492 D433G possibly damaging Het
Mir700 C A 4: 135,412,307 probably null Het
Mroh9 A T 1: 163,075,677 F52L probably damaging Het
Mycbp2 A C 14: 103,156,723 S2691A probably benign Het
Nktr T A 9: 121,748,394 probably benign Het
Obsl1 C A 1: 75,492,215 probably null Het
Olfr1130 A T 2: 87,608,080 I231F probably damaging Het
Olfr251 T C 9: 38,378,309 S137P probably damaging Het
Olfr259 A G 2: 87,108,063 V108A probably benign Het
Olfr582 A T 7: 103,041,646 I51F probably damaging Het
Olfr855 C T 9: 19,584,885 T116I probably benign Het
Pcdhb22 T A 18: 37,519,736 I162N possibly damaging Het
Pde1c A T 6: 56,479,202 probably null Het
Pds5b A G 5: 150,769,776 probably null Het
Pkd1l1 A C 11: 8,857,113 W1568G probably damaging Het
Polr3c A T 3: 96,719,468 M258K possibly damaging Het
Prss12 A T 3: 123,482,768 I349F probably benign Het
Ptpn21 A G 12: 98,678,552 *1177Q probably null Het
Rgs22 T A 15: 36,010,567 K1125M probably benign Het
Rnf182 A G 13: 43,668,035 K21E probably damaging Het
Rpl6 G A 5: 121,205,514 probably benign Het
Samsn1 C T 16: 75,873,514 V234I probably benign Het
Scrib A G 15: 76,057,751 I1089T probably damaging Het
Sec31a T C 5: 100,363,878 T1092A probably damaging Het
Sh3bp2 G T 5: 34,562,465 R606L possibly damaging Het
Sipa1 A G 19: 5,656,201 V367A probably damaging Het
Slc25a44 C T 3: 88,412,846 E269K probably damaging Het
Slc44a4 T A 17: 34,923,454 M353K possibly damaging Het
Sorcs2 A G 5: 36,019,384 S1142P probably damaging Het
Sptbn4 A G 7: 27,418,599 F352L probably damaging Het
Synj1 A T 16: 90,969,286 N541K probably damaging Het
Tas2r113 G A 6: 132,893,696 R229K probably benign Het
Tcaf3 A T 6: 42,589,971 I728K probably benign Het
Tcea1 A G 1: 4,890,773 E167G probably benign Het
Timeless G A 10: 128,244,200 R406H probably damaging Het
Traf6 C T 2: 101,696,684 R260* probably null Het
Traj31 C T 14: 54,187,931 probably benign Het
Ttn A T 2: 76,769,563 V19089D probably damaging Het
Unc80 C T 1: 66,627,257 S1868L possibly damaging Het
Wdr38 A T 2: 39,001,321 I287F possibly damaging Het
Wnt2 G A 6: 18,030,323 probably benign Het
Wnt5b G A 6: 119,433,654 P288L probably benign Het
Xkr5 G T 8: 18,934,505 N174K probably benign Het
Zbtb6 C T 2: 37,428,965 R317Q probably damaging Het
Zcchc7 AGGGG AGGG 4: 44,931,218 probably null Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Lrrfip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Lrrfip1 APN 1 91068621 missense probably damaging 1.00
IGL00835:Lrrfip1 APN 1 91115418 missense possibly damaging 0.89
IGL01603:Lrrfip1 APN 1 91115913 missense probably benign 0.03
IGL02261:Lrrfip1 APN 1 91112168 missense probably benign 0.22
IGL02401:Lrrfip1 APN 1 91114928 missense probably benign 0.21
IGL02690:Lrrfip1 APN 1 91053661 missense probably damaging 0.97
R0048:Lrrfip1 UTSW 1 91093647 splice site probably benign
R0048:Lrrfip1 UTSW 1 91093647 splice site probably benign
R0891:Lrrfip1 UTSW 1 91068615 missense probably damaging 1.00
R1210:Lrrfip1 UTSW 1 91115193 missense probably benign 0.16
R1352:Lrrfip1 UTSW 1 91115367 missense probably benign
R1488:Lrrfip1 UTSW 1 91114632 missense probably damaging 1.00
R1600:Lrrfip1 UTSW 1 91114667 missense probably damaging 0.98
R1718:Lrrfip1 UTSW 1 91115555 missense probably damaging 0.99
R2056:Lrrfip1 UTSW 1 91115817 missense probably benign 0.25
R2993:Lrrfip1 UTSW 1 91105234 missense probably damaging 0.99
R3782:Lrrfip1 UTSW 1 91112189 missense possibly damaging 0.82
R4191:Lrrfip1 UTSW 1 91110399 missense probably benign 0.39
R4675:Lrrfip1 UTSW 1 91103320 critical splice donor site probably null
R4732:Lrrfip1 UTSW 1 91115647 missense probably benign 0.29
R4733:Lrrfip1 UTSW 1 91115647 missense probably benign 0.29
R5196:Lrrfip1 UTSW 1 91114608 missense probably damaging 1.00
R5250:Lrrfip1 UTSW 1 91115896 missense possibly damaging 0.90
R5433:Lrrfip1 UTSW 1 91087126 critical splice donor site probably null
R6218:Lrrfip1 UTSW 1 91082159 missense probably damaging 0.96
R6600:Lrrfip1 UTSW 1 91115847 missense probably damaging 0.99
R6847:Lrrfip1 UTSW 1 91105128 missense probably damaging 1.00
R6911:Lrrfip1 UTSW 1 91114807 nonsense probably null
R6940:Lrrfip1 UTSW 1 91122413 splice site probably null
R6976:Lrrfip1 UTSW 1 91115015 missense probably benign 0.00
R7002:Lrrfip1 UTSW 1 91115458 missense probably benign 0.31
R7205:Lrrfip1 UTSW 1 91091616 missense probably benign 0.00
R7363:Lrrfip1 UTSW 1 91123120 missense probably benign 0.05
R7552:Lrrfip1 UTSW 1 91105283 missense probably damaging 1.00
R7910:Lrrfip1 UTSW 1 91120152 missense possibly damaging 0.88
R7991:Lrrfip1 UTSW 1 91120152 missense possibly damaging 0.88
R8006:Lrrfip1 UTSW 1 91076951 missense probably damaging 1.00
R8068:Lrrfip1 UTSW 1 91128102 missense probably damaging 1.00
X0057:Lrrfip1 UTSW 1 91115403 missense possibly damaging 0.67
Z1088:Lrrfip1 UTSW 1 91115530 intron probably benign
Z1176:Lrrfip1 UTSW 1 91101199 missense possibly damaging 0.66
Z1177:Lrrfip1 UTSW 1 91122494 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CAATTGCTGCTTTGACACACAG -3'
(R):5'- ACATTTGGCCCCTGCTAGTG -3'

Sequencing Primer
(F):5'- GCTTTGACACACAGGCCCAG -3'
(R):5'- TGCTAGTGGTCCCGGGG -3'
Posted On2017-06-26