Mutagenetix > Incidental Mutations

Incidental Mutation 'R6005:Map2k5'

479428

Institutional Source

Beutler Lab

Gene Symbol

Map2k5

Ensembl Gene

ENSMUSG00000058444

Gene Name

mitogen-activated protein kinase kinase 5

Synonyms

MEK5

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6005 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

63163768-63377902 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 63281019 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 283 (D283N)

Ref Sequence

ENSEMBL: ENSMUSP00000034920 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034920]

PDB Structure

Solution structure of the PB1 domain of mouse mitogen activated protein kinase kinase 5 (MAP2K5) [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034920
AA Change: D283N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034920
Gene: ENSMUSG00000058444
AA Change: D283N

Domain	Start	End	E-Value	Type
PB1	18	97	7.59e-12	SMART
S_TKc	166	419	7.75e-71	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213604

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.2%
20x: 90.9%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase specifically interacts with and activates MAPK7/ERK5. This kinase itself can be phosphorylated and activated by MAP3K3/MEKK3, as well as by atypical protein kinase C isoforms (aPKCs). The signal cascade mediated by this kinase is involved in growth factor stimulated cell proliferation and muscle cell differentiation. Three alternatively spliced transcript variants of this gene encoding distinct isoforms have been described. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygous mutants die at E10.5 and exhibit abnormal cardiac development and a decrease in proliferation and an increase in apoptosis in the heart, head, and dorsal regions of the embryo. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810006K23Rik	G	T	5: 124,340,774	E153*	probably null	Het
4930412O13Rik	T	C	2: 9,882,827		probably benign	Het
7530416G11Rik	A	T	15: 85,494,109	I111N	unknown	Het
Adgb	C	T	10: 10,395,352	R849H	probably damaging	Het
Ahnak	T	C	19: 9,015,161	V4603A	possibly damaging	Het
AI464131	T	A	4: 41,498,895	H245L	probably benign	Het
Ank1	A	G	8: 23,132,202	D1589G	probably damaging	Het
Ankrd2	A	G	19: 42,040,115	D70G	probably damaging	Het
Arid2	T	C	15: 96,370,972	S989P	probably benign	Het
Bbs1	A	T	19: 4,903,795	Y113*	probably null	Het
Bfsp2	T	G	9: 103,448,550	K298T	probably damaging	Het
Bpi	G	A	2: 158,262,480	V168I	possibly damaging	Het
Cacna2d1	T	C	5: 16,361,821	S921P	probably damaging	Het
Clec4d	A	C	6: 123,267,159	T76P	probably damaging	Het
Coq8b	C	T	7: 27,257,325	Q468*	probably null	Het
Dennd6b	T	C	15: 89,188,168	E248G	possibly damaging	Het
Ednra	A	G	8: 77,674,927	S245P	possibly damaging	Het
Epb41l4a	C	T	18: 33,828,143	C446Y	probably benign	Het
Fam221a	A	G	6: 49,367,822		probably benign	Het
Fam229a	T	C	4: 129,491,503	S76P	probably benign	Het
Fryl	C	T	5: 73,083,295	D1321N	probably damaging	Het
Gli2	C	T	1: 118,842,064	R586H	probably damaging	Het
Gm13089	T	A	4: 143,698,432	H147L	probably benign	Het
Gm94	C	T	18: 43,792,797	A16T	possibly damaging	Het
Gorasp2	T	C	2: 70,690,751	V355A	probably benign	Het
Grid1	C	A	14: 35,323,412	T404N	probably damaging	Het
Gtf2i	C	A	5: 134,255,958	E475*	probably null	Het
Gucy1a2	T	C	9: 3,865,518		probably null	Het
Hs3st5	T	A	10: 36,832,928	I153N	probably damaging	Het
Il11ra1	T	C	4: 41,763,887		probably null	Het
Ireb2	G	A	9: 54,908,805	G887S	probably damaging	Het
Kdsr	T	C	1: 106,734,581	E248G	probably benign	Het
Lemd2	C	G	17: 27,190,785	R464P	probably damaging	Het
Lrrfip1	T	C	1: 91,114,611	V246A	probably damaging	Het
Macf1	T	A	4: 123,474,275	D2231V	possibly damaging	Het
Mfsd5	A	G	15: 102,281,492	D433G	possibly damaging	Het
Mir700	C	A	4: 135,412,307		probably null	Het
Mroh9	A	T	1: 163,075,677	F52L	probably damaging	Het
Mycbp2	A	C	14: 103,156,723	S2691A	probably benign	Het
Nktr	T	A	9: 121,748,394		probably benign	Het
Obsl1	C	A	1: 75,492,215		probably null	Het
Olfr1130	A	T	2: 87,608,080	I231F	probably damaging	Het
Olfr251	T	C	9: 38,378,309	S137P	probably damaging	Het
Olfr259	A	G	2: 87,108,063	V108A	probably benign	Het
Olfr582	A	T	7: 103,041,646	I51F	probably damaging	Het
Olfr855	C	T	9: 19,584,885	T116I	probably benign	Het
Pcdhb22	T	A	18: 37,519,736	I162N	possibly damaging	Het
Pde1c	A	T	6: 56,479,202		probably null	Het
Pds5b	A	G	5: 150,769,776		probably null	Het
Pkd1l1	A	C	11: 8,857,113	W1568G	probably damaging	Het
Polr3c	A	T	3: 96,719,468	M258K	possibly damaging	Het
Prss12	A	T	3: 123,482,768	I349F	probably benign	Het
Ptpn21	A	G	12: 98,678,552	*1177Q	probably null	Het
Rgs22	T	A	15: 36,010,567	K1125M	probably benign	Het
Rnf182	A	G	13: 43,668,035	K21E	probably damaging	Het
Rpl6	G	A	5: 121,205,514		probably benign	Het
Samsn1	C	T	16: 75,873,514	V234I	probably benign	Het
Scrib	A	G	15: 76,057,751	I1089T	probably damaging	Het
Sec31a	T	C	5: 100,363,878	T1092A	probably damaging	Het
Sh3bp2	G	T	5: 34,562,465	R606L	possibly damaging	Het
Sipa1	A	G	19: 5,656,201	V367A	probably damaging	Het
Slc25a44	C	T	3: 88,412,846	E269K	probably damaging	Het
Slc44a4	T	A	17: 34,923,454	M353K	possibly damaging	Het
Sorcs2	A	G	5: 36,019,384	S1142P	probably damaging	Het
Sptbn4	A	G	7: 27,418,599	F352L	probably damaging	Het
Synj1	A	T	16: 90,969,286	N541K	probably damaging	Het
Tas2r113	G	A	6: 132,893,696	R229K	probably benign	Het
Tcaf3	A	T	6: 42,589,971	I728K	probably benign	Het
Tcea1	A	G	1: 4,890,773	E167G	probably benign	Het
Timeless	G	A	10: 128,244,200	R406H	probably damaging	Het
Traf6	C	T	2: 101,696,684	R260*	probably null	Het
Traj31	C	T	14: 54,187,931		probably benign	Het
Ttn	A	T	2: 76,769,563	V19089D	probably damaging	Het
Unc80	C	T	1: 66,627,257	S1868L	possibly damaging	Het
Wdr38	A	T	2: 39,001,321	I287F	possibly damaging	Het
Wnt2	G	A	6: 18,030,323		probably benign	Het
Wnt5b	G	A	6: 119,433,654	P288L	probably benign	Het
Xkr5	G	T	8: 18,934,505	N174K	probably benign	Het
Zbtb6	C	T	2: 37,428,965	R317Q	probably damaging	Het
Zcchc7	AGGGG	AGGG	4: 44,931,218		probably null	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het

Other mutations in Map2k5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00780:Map2k5	APN	9	63281077	splice site	probably benign
IGL01412:Map2k5	APN	9	63293706	missense	probably damaging	1.00
IGL01766:Map2k5	APN	9	63377227	missense	probably benign
IGL02246:Map2k5	APN	9	63377129	missense	probably benign	0.10
IGL02270:Map2k5	APN	9	63322197	splice site	probably null
IGL02793:Map2k5	APN	9	63257039	missense	probably benign	0.32
IGL03236:Map2k5	APN	9	63286392	splice site	probably benign
R0007:Map2k5	UTSW	9	63293724	missense	probably damaging	1.00
R0217:Map2k5	UTSW	9	63256975	critical splice donor site	probably null
R0315:Map2k5	UTSW	9	63303151	missense	probably damaging	1.00
R0801:Map2k5	UTSW	9	63357979	splice site	probably benign
R1122:Map2k5	UTSW	9	63263163	missense	probably damaging	1.00
R1822:Map2k5	UTSW	9	63235303	missense	possibly damaging	0.79
R4308:Map2k5	UTSW	9	63235304	missense	probably benign	0.02
R4421:Map2k5	UTSW	9	63164130	missense	probably damaging	0.96
R4720:Map2k5	UTSW	9	63293719	missense	probably damaging	1.00
R4869:Map2k5	UTSW	9	63322243	nonsense	probably null
R5059:Map2k5	UTSW	9	63257014	missense	probably benign	0.41
R5138:Map2k5	UTSW	9	63263158	missense	probably damaging	0.99
R6258:Map2k5	UTSW	9	63217365	missense	probably benign	0.16
R6261:Map2k5	UTSW	9	63338098	missense	probably benign	0.00
R6498:Map2k5	UTSW	9	63286401	missense	possibly damaging	0.74
R6808:Map2k5	UTSW	9	63322246	missense	probably benign	0.00
R7228:Map2k5	UTSW	9	63358022	missense	probably damaging	1.00
R7819:Map2k5	UTSW	9	63358018	missense	probably damaging	0.99
R8053:Map2k5	UTSW	9	63343425	missense	probably benign	0.16
Z1176:Map2k5	UTSW	9	63358038	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACATCTGAAGTGCTCCGAGG -3'
(R):5'- AATGTGGAGCTCTGCAGTTG -3'

Sequencing Primer
(F):5'- CAATGCTTGAAAAATGTGGCTC -3'
(R):5'- AACTGTGGAGCATTCCCT -3'

Posted On

2017-06-26